Skip to main content

Table 4 Primers used in this work

From: Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli

Primer Sequence (5–3)
flu-FW AAGCAGCGGCAGCTATGGATTC
flu-Rev ACCGGCAACCTCTGTTCTCATC
bssS-FW GTTGCGTTTGCACTACCAGACC
bssS-Rev ACCAGAGCGTCTGACCAACTTC
bssR-FW CAGCGAATCGATCTGCTGAACC
bssR-Rev TGCCTTCCTCAGTTGCACGTATG
flhC-FW CGATGCGGTGATCAAAGCCTAC
flhC-Rev ATGCCAGCAGTGGTCCTTCTTC
flgJ-FW CTGGGATGCGCAATCACTCAAC
flgJ-Rev ATATTTGCCGCCGGATCTTCGC
fliH-FW GCGCTACCTTAAGTTTGCATGGC
fliH-Rev AGACTTTACAGCCGCCAGGATG
fliA-FW AGCGTGGAACTTGACGATCTGC
fliA-Rev TTGTAGGGCGTCATAGCGTTCG
cysG-FW GACGCTGGTGTTCTATATGGG
cysG-Rev GGCATTCCGTGTTCAATCAG