Skip to main content

Table 2 Primer sequences used for dsRNA synthesis

From: A de novo transcriptome of the noble scallop, Chlamys nobilis, focusing on mining transcripts for carotenoid-based coloration

Primer Sequence
1Fi CGATTTTGGAACGGTAACAGTAACTTGGA
1Ri ATGGATTGACTGATGTGAGATGT
2Fi GATCACtaatacgactcactatagggAACGGTAACAGTAACTTGGA
2Ri GATCACtaatacgactcactatagggTGAGATGTTTGATGATTTCCGTA
EGFPF GATCACtaatacgactcactatagggCAGTGCTTCAGCCGCTACCC
EGFPF GATCACtaatacgactcactatagggAGTTCACCTTGATGCCGTTCTT
  1. Note: The lower case is T7 promoter sequence.