Skip to main content

Table 2 Oligonucleotides used in this study

From: Complete genome sequence of the Clostridium difficile laboratory strain 630Δerm reveals differences from strain 630, including translocation of the mobile element CTn5

Name Sequence (5’ – 3’) Description
oWKS-1467 CGCACCAGAATGGAAAGAAG Left junction CTn5 a
oWKS-1468 AGGCGTACACTGTGGGATAG Left junction CTn5 b
oWKS-1469 TAGATGATGCCGTTGCTGAG Right junction CTn5 b
oWKS-1470 AAGGTTTGGGTCTGCTGTAG Right junction CTn5 a
oWKS-1471 CCGTTACCGTCTGTAATG rumA geneb
oWKS-1472 AGGGCCTATAAGGTAAGC rumA geneb
  1. aThe repaired junction (CTn5 excised from CD1844) is detected with oWKS-1467 and oWKS-1470. bThe insertion of CTn5 into rumA is detected by primer combination oWKS-1468/oWKS-1472 and/or oWKS-1469/oWKS-1471.