Skip to main content

Table 4 Characteristics of the novel microsatellite marker system and the genetic diversity of Chengdu captive giant panda population, including locus names, primer sequences, accession number, repeat unit, fluorescent dyes, annealing temperatures (Tm), length (bp), numbers of individuals genotyped (N), numbers of alleles(k), observed heterzygosity (HObs), expected heterzygosity (HExp), allelic richness (A R ), Polymorphism Information Contents (PIC), HWE P values (P-value)

From: Genome-wide survey and analysis of microsatellites in giant panda (Ailuropoda melanoleuca), with a focus on the applications of a novel microsatellite marker system

Locus name Primer sequences(5′—3′) Accession no. Repeat unit Fluorescent dyes Tm (°C) Length (bp) N k HObs HExp A R PIC P-value
gpz-6 F: CCTGGCAGGGCAAAGTATT KF907161 (AAAG)11 FAM 60 202 56 6 0.714 0.689 6.000 0.633 0.2615
R: CCCCGTGAAAACATCAAGAC
gpz-47 F: GACCTCAGTGTACGCCCAGT KF907176 (AATG)20 TAMRA 60 230 57 4 0.544 0.524 4.000 0.468 0.3557
R: CTGGACAGGCAGGTAGAAGC
gpz-20 F: CCCTCTCGTTGTGTCTCTCTG KF907169 (AAAG)10 FAM 63 248 52 10 0.731 0.724 10.000 0.695 0.1302
R: CACCTGGTAAATGGCACCTT
GPL-47 F: TCCCCCTCTATGGTAAAAGG KF907147 (TCTA)20 FAM 65 180 53 6 0.849 0.819 6.000 0.783 0.2161
R: CCATGTTGGGTGTAGGGATT
GPL-29 F: TCCAAGGCTTCAAACAAGGT KF907139 (ATCC)19 TAMRA 60 215 56 4 0.714 0.677 4.000 0.617 0.2800
R: CACCACAGGTGCCAATTATG
GPL-60 F: TGCCGGAAAGTTCTAAGCAT KF907152 (TCTT)12 FAM 63 218 57 5 0.702 0.719 5.000 0.668 0.3991
R: TTTCTCTCCCTCTCCCCTTC
gpz-54 F: CAATATTTTAAGGCGTGGGACT KF907181 (AGAT)18 TAMRA 63 245 56 5 0.714 0.704 4.929 0.643 0.6226
R: GCATAATTGCAGAACCAGAGC
GPL-8 F: TGGTTTTGCAAGGATGACAG
R:TTGTGACAAGCAAGCTCCAC
KF907132 (ATCC)11 HEX 63 248 54 4 0.648 0.639 4.000 0.584 0.4311
GPL-31 F: GCATCCTTGTCCTCTTGGAG KF907141 (ATCT)21 FAM 60 183 57 3 0.632 0.585 3.000 0.490 0.1640
R:GCATTGTTTTCTACTCTACAAATATCC
GPL-44 F: TTCTCCCTCTGTCTGCCACT KF907146 (ATAA)21 FAM 63 232 53 3 0.491 0.525 3.000 0.461 0.2543
R: ACCATTCTGGGTGCGATAAC
gpz-51 F: GGGGAGGATATGTGTTGTGG KF907179 (AGAT)11 TAMRA 60 175 57 4 0.579 0.503 3.993 0.424 0.0440
R: TGCTTTGGATTTATTGGAGCA
GPL-28 F: GAAAGAAGGGCAGGGATAGG KF907138 (ATAA)21 FAM 63 238 56 3 0.536 0.486 2.995 0.382 0.2594
R: TGACCAAGAACTCACGGTTG
GPL-53 F: CCAGAAAATGGCTTTCATGC KF907148 (ATTT)21 HEX 65 210 55 6 0.382 0.380 5.997 0.362 0.6395
R: TCTCTTTCTCTGCCCCACAC
gpy-20 F: GCAGGCACTCAAGAGGTGTT KF907159 (TTTG)16 TAMRA 63 197 56 3 0.482 0.492 3.000 0.439 0.8984
R: CCTTGTGCTAAACACAGGTGA
gpy-5 F: CTCGGGAGCTTTGTACCATC KF907157 (AACT)16 HEX 63 228 57 4 0.509 0.510 3.993 0.459 0.4341
R: CAGAGAGCCCAAACCTCAAC
Mean         4.7 0.615 0.598 4.660 0.541 ---