Skip to main content

Table 1 Primer for quantitative real-time PCR

From: De novo assembly and transcriptome analysis of Atlantic salmon macrophage/dendritic-like TO cells following type I IFN treatment and Salmonid alphavirus subtype-3 infection

Primer name Sequence GeneBank Acc
TLR3-F TTTGATGAGTCTCCGCCAACTCCA BK008646
TLR3-R AATCTGCGAGGGACACAAAGGTCT  
LPG2-F GTGGCAGGCAATGGGGAATG FN396358
LPG2-R CCTCCAGTGTAATAGCGTATCAATCC  
Viperin-F GTGGAAGAGGCCATTCAGTTCAGT BT047340
Viperin-R AGTGCAGTTATACAGGCGGAA  
CCL19-F TGGACCGCCTCATCAAGAAGTGC BT125321
CCL19-R ATGGGGGTGGAGGTGGTGGTGTT  
Galectin9-F TTAACCTGCGTTTCAACTCGG BT046997
Galectin9-R TGGACCCCACTGTTCCTTCA  
Galectin3-binding-F CCAGACCAACAGTGTTCACTTCAGC BT059216
Galectin3-binding-R ACGTGAAAGACATACCTGCCCTCAC  
STAT1-F CGGGCCCTGTCACTGTTC GQ325309
STAT1-R GGCATACAGGGCTGTCTCT  
MHCI-F ACCTGAAGAGAGCGACATGGA HM181991
MHCI-R CCCTTCCCACTTCATTTTGGA  
TRIM16-F GGACCAAGATCTCCACTACAG BT046063
TRIM16-R CTGTGTTTGGGTCCAGTGTG  
IFIT5-F GCTGGGAAGAAGCTTAAGCAGAT BT046021
IFIT5-R TCAGAGGCCTCGCCAACT  
PBEF-F CACCAACAGGAGACTTTGTGACA BT072670
PBEF-R AAGCAGATCTGGACCGTATTCC  
IRF7B-F GAGGAGTGGGCAGAGAACTA NM_001171850
IRF7B-R TTCTGGGAGACTGGCTGGG  
β-actin-F CCAGTCCTGCTCACTGAGGC AF012125
β-actin-R GGTCTCAAACATGATCTGGGTCA  
Errfi-F ACCTACATCCCCACCCTAAC NM_001173711
Errfi-R CAGAAACACACTGCCATCC  
AP1-F TCTGTCCCAAGAACATCACC BT045224
AP1-R TCTGAGAGTCACAACTGCC  
Decorin-F ACCTGGCTAAGCTGGGTCTA NM_001173562
Decorin-R TGTCCAGGTGAAGCTCTCTG  
CD209-F TCTGACCCTGAAGCTGAAC NM_001124633
CD209-R ACACTCCCTACACTTCCTTAC  
C7-1-F ATACCAATGCCAGCCTTCC NM_001124618
C7-1-R ATCCGACCAATCACAATCAC  
C1qt5-F AGAAGGGAGAGAAGGGAGAC NM_001140506
C1qt5-R GCTGAAGGCTGATTTGGGAG  
Cacb2-F AGAGCAGAGAAAGCAGAGAC NM_001173925
Cacb2-R TCATACTCCTCCTCTCCAAAC  
CtlrA -F AAACGCATTTGTCAGATGGA NM_001123579
CtlrA-R GGAAGTTCATGGCTTGGTTT