Skip to main content

Table 3 Primer sequences of candidate SNP sex markers used in for SNaPshot and HRM analysis in pistachio

From: Identification of sex-linked SNP markers using RAD sequencing suggests ZW/ZZ sex determination in Pistacia vera L.

No Marker name Primer Position Sequence (5′-3′) Product size (bp)
1 SNP-PIS-112277 Forward   TTACAGACACAAAACCATGACAA 50
   Reverse   GCATGCTGAATTTTCTTCCT  
   Single base extension 61-R GCATGCTGAATTTTCTTCCTT  
2 SNP-PIS-127343 Forward   TCACCAATATTTTACTGCAA 56
   Reverse   CCATTTTCACTCACCCTGTC  
   Single base extension 27-S CACCCTGTCATTACATTCTTA  
3 SNP-PIS-133396 Forward   GCAAACCGCAAAGAAGATTA 52
   Reverse   ACTGAAACTTGAAGATCATGGA  
   Single base extension 46-S CAAACCGCAAAGAAGATTAAAGTA  
    47-Y GTACTGAAACTTGAAGATCATGGATCA  
4 SNP-PIS-135862 Forward   GGTTTTGTGTCTGAATGTGGA 64
   Reverse   CCATGCACATTTCCCATAAT  
   Single base extension 40-Y GTCTGAATGTGGATAATATATGG  
    41-Y TTCCCATAATCAACATGAGGC  
5 SNP-PIS-136404 Forward   GAATTCTTTTAGGGGTTGTCA 67
   Reverse   CCAGCTTTAGAGTTGGCAAT  
   Single base extension 23-K GAATTCTTTTAGGGGTTGTCAAA  
6 SNP-PIS-167992 Forward   CGAAAAATAACTTCATAGCGTGA 69
   Reverse   TGATCAATTGCAGCTTAGGG  
   Single base extension 36-W AGCTTAGGGTTGCGGTTA  
7 SNP-PIS-174431 Forward   AGTCTCTAGCCGCGTACATA 64
   Reverse   AACTTAACAATTTYTCCACTTTCAC  
   Single base extension 56-M CCGCGTACATATAAAAATTAACTACTCA