Skip to main content

Table 4 Primers of four defense genes

From: Proteomics of methyl jasmonate induced defense response in maize leaves against Asian corn borer

Genes Expressed level Primers for qRT-PCR Primers for expression vectors
Actin - S- 5′ CGGCAGCCTCCATACCAA 3′ -
A - 5′ GCCAAGAACAGCTCCTCA 3′ -
bgl Up S- 5′ TCGCCACAAAGCAGTAAGC 3′ S- 5′gcGAGCTCATGGCTCCACTTCTCGCCGCAG3′
A- 5′ ACCAAAGATGAAGTCAGAGGG 3′ A - 5′cgCTCGAGAGCTGGCGTAATAATCTTCTTG3′
TRXM Up S- 5′ TTGGTGATGGCGTGCGAGAC 3′ S- 5′gcGGATCCATGGCCATGGAGACGTGCTT3′
A- 5′ TGGATGCCGTAGGCGTCGT 3′ A - 5′cgAAGCTTTGAGCTACCGATGTACTTGT3′
PR1 Up S- 5′ TCGCACATCAAGGTGGAGC 3′ S- 5′gcGGATCCATGGCCTCCGTCAACAGCT3′
A- 5′ ATGGTTTAGTTGTAGGCGTCGG 3′ A - 5′cgAAGCTTGTTGTAGGCGTCGGGGTT3′
RAB15 Down S- 5′ GAGAATGCCTTCGCCTCCTAC 3′ S- 5′ gcGGATCCATGGCGGCGGCTGATGTGGAGT3′
A- 5′ GTCGAGCTCCTTGCCGTT 3′ A - 5′cgAAGCTTGTCCCTCCAGCCGCCGCCG3′
  1. Notes: The bold sequences are restriction enzyme sites. S: upstream primers; A: downstream primers.
\