Skip to main content

Table 1 Fruit shape and size marker information

From: Genomic variation in tomato, from wild ancestors to contemporary breeding accessions

Gene Primer sequence (5′ to 3′) Polymorphism Restriction enzyme Wild-type allele size (bp) Cultivated allele size (bp) Reference
FW2.2/CNR CATATAAAGTGTACTGACCGTCA SNP Tsp45I 168 149 This paper
CTGTCCTATTCAAGAGGTAAATGAG
FW3.2/SlKLUH AAAGTCGAATAAATTAGATGAACTTGA SNP Hpy188I 326 304 Chakrabarti et al. [29]
ATTGGGTCTCTCCTCGCTCT
LC GCCGAACACATCAACATTTC SNP HindIII 260 235 *Muños et al. [28]
CCTTTTCCTAAAAGATTTGGCATGAAG
FAS CCAATGATAATTAAGATATTGTGACG Inversion - 466 335 Rodríguez et al. [30]
ATGGTGGGGTTTTCTGTTCA
CAGAAATCAGAGTCCAATTCCA
OVATE AAGCTGATACCGTGTAGTGTGG SNP DdeI 122 109 *Rodriguez et al. [30]
AATGCTTTCCGTTCAACGAC
SUN TTTACCCGATGTGAAAACGA RFLP EcoRV   An additional 4.3-kb fragment Xiao et al. [26]
CATCAATAGTCCAAGGGGAAA
  1. *Marker that is modified from the original.