Skip to main content

Table 2 Primers for end-point RT-PCR

From: DNA methylation of the LIN28 pseudogene family

MAN2A1 Forward GACCCATTTGGACATTCACC
  Reverse TTTAGGATCAGGCCCACAAG
ACADSB Forward TGGAAAACTCCTCCTCATGC
  Reverse CAACTTGTTCCTGGGCAAAT
IKZF5 Forward GAGAAGAAACCGGAGCCTTT
  Reverse AGGTCCTTTCAAACCCGTCT
DHDDS Forward GTCATTTTGGGAGCGGTTCT
  Reverse GCCAGTTTGTTGAAGCCTTG
LIN28 Forward TGCAGAAACGCAGATCAAAG
  Reverse TTCTTCCTCCTCCCGAAAGT
ACTB Forward ATGGGCCAGAAGGACTCGTA
  Reverse CTTCTCCATGTCGTCCCAGT