Skip to main content

Table 6 Primers used in this study

From: Genomic features separating ten strains of Neorhizobium galegae with different symbiotic phenotypes

Primer Sequence 5′-3′
PCR amplification  
RpoNLLSpeI TTTAAAACTAGTTTGATATCGTCACCAATGGC
RpoNLRBamHI AAATTTGGATCCGTTTTCATTCAGAGCTCCTG
nifQLLSpeI-ori TTTAAAACTAGTCGATCGTCGTGAGCGCAATG
nifQLRBamHI-ori AAATTTGGATCCAGTTTCCATCCTGCGACCTC
nifQLLSpeI-2 AAATTTACTAGTGCTGCATCTCGGGAGGTCGAT
nifQLRBamHI-2 TTTAAAGGATCCAGCCATCTCGCAATTCACAGCG
RpoNRLBglII AAATTTAGATCTTTCTGACTCTGTCATGCTTC
RpoNRRXhoI TTTAAACTCGAGGTCCATAGTAAGTGCCGTGA
nifQRLBamHI AAATTTGGATCCCGACAATGATTGCGAATCAAGC
nifQRRXhoI TTTAAACTCGAGCGGCCGAACCCTTTGAACTC
rpoNmutLL AAACAAGATCATGCCATCGG
540nifQL-1234F TAGTCCGCCTGAGTCCAGAG
1141nifQL-1184F GCTTGTGATTGACGAGGTG
hsnTmutLR ACTATCAGGTCAAGTCTGCT
hsnTmutRL TTGATGTTACCCGAGAGCTT
rpoNmutRR CTTCATCCGATCCTGGAGTA
nifQR-1209R TCGCTATTGCATTGCCGATT
Sequencing  
rpoNL-646 TGCAGTACAGCGATTGTGACG
oriNifQL-570 TGACGCAAGCAGTCGGCAAC
offNifQL-661 CATGGCAACGATGGCAAGTC
rpoNR-413 GCAACCGCAACGTGTATTCG
oriNifQR-583 GGATATTGCCATCCGCGAAG
offNifQR-560 TACCGAGATGAACAGCACCTG
\