Characterization of repetitive DNA landscape in wheat homeologous group 4 chromosomes

BMC Genomics

Table 4 Description of the 6 LTR retrotransposon candidates identified on 4D chromosome scaffolds

LTR retrotranspoon	program	LTR retrotransposon size	# in genome	LTR region similarity	5′-LTR size	3′-LTR size	Insertion time (years x 10 ⁶ )	TSD	PBS	PPT
RLC_Genoveva_JROL01007197	STRUC/FINDER	5132	30	0.978	215	215	0.70	GAGGC	Lys_TT	GCCTCCCTCTTCCTC
RLC_Carmen_JROL01007734	FINDER	4597	40	0.977	131	131	0.27	-	SerTGA	CCATCTTCTTCCTCC
RLC_Facunda_JROL01000922	FINDER	4842	757	0.942	138	139	4.65	-	MetCAT	GATACTGCGGGGGGA
RLG_Francisca_JROL01008273	STRUC/FINDER	5279	21	0.969	321	321	0.70	CTGTC	SerGCT	TCTCCTGGTCCTCCC
RLX_Victoria_JROL01006440	FINDER	1898	121	0.960	375	375	0.97	-	MetCAT	TCATCCTCTCGCCCT
RLX_Gabrielle_JROL01007833	STRUC	2644	33	0.935	685	680	6.11	ACATT	MetCAT	ATAGCTTCGTTCCAAGAAGGAGGGGA

The designations on the new LTR retrotransposons are indicated in column 1. The number of genomic repetitions for each candidate LTR retrotransposon was estimated by searching against the T. aestivum chromosome arm contigs deposited in the URGI database (# in genome). LTR: Long terminal repeat; TSD: target site duplication; PBS: primer binding site; PPT: polypurine tract. The last column indicates the presence (+) or absence (-) of retrotransposon proteins when BLAST searched against the TREP protein database.

ISSN: 1471-2164