Skip to main content

Table 2 Primers used for real-time PCR

From: A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease

Primer name Primer sequence Amplicon size (bp) chr Genomic location (GRCh37/hg19)
HMBS-F TGCACGGCAGCTTAACGAT 201 11 118963966-118964166
HMBS-R AGGCAAGGCAGTCATCAAGG
PRODH-F GGGAAAGGAGAGTTCAGGCAG 101 22 18918663-18918763
PRODH-R GCTTGTTGAATAGCCTCTGTCCTAG
DGCR6-F GTGAAGGAGTTGCCCAGGTA 132 22 18893981-18894112
DGCR6-R TCAGCGTGGTGTAGGACAAG
TOP3B-F CTGGATGACTTCGAGCTGGT 162 22 22312808-22312969
TOP3B-R TGGCACTGAAAAGAGACTGC