Skip to main content

Table 2 Prepared primer list

From: A novel termini analysis theory using HTS data alone for the identification of Enterococcus phage EF4-like genome termini

Primer Sequence (From 5′ to 3′)
P1 CTCTAGTTTGTTGCGTGCGTAAATC
P2 GATATCTGCAGAGCTCCGGC
P3 GCCGGAGCTCTGCAGATATC
P4 AGGTACGGACCGCAATGGGTTGGGA