Skip to main content

Table 3 IME-EF4 and IME-EFm1 terminal sequence frequency statistics

From: A novel termini analysis theory using HTS data alone for the identification of Enterococcus phage EF4-like genome termini

Phage Strand Ave. Freq. Ter. Freq. \( \frac{\mathrm{Ter}.\mathrm{Freq}.}{\mathrm{Ave}.\mathrm{Freq}.} \) Terminal Sequence
IME-EF4 Positive 6.73 1,322 196 ATTAGTTTCTTCAAAAAATT
Negative 6.73 2,318 344 CTTTCGCTTAAACGAATCTC
IME-EFm1 Positive 12.95 3,194 246 ATTAATTCGTTATAAAAAGG
Negative 12.95 4,412 341 CTCTTCTTCGCACGAAATTC