Skip to main content

Table 3 miRNAs in which major isomiRs exhibited 5′ variation among tissues and their expression levels

From: Deep sequencing, profiling and detailed annotation of microRNAs in Takifugu rubripes

miRNA Major sequence Seed sequence Expression level Tissue
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 47 Fast muscle
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 119 Slow muscle
fru-miR-462-5p TAACGGAACCCATAATGCAGCT AACGGAA 253 Heart
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 30 Eye
fru-miR-462-5p TAACGGAACCCATAATGCAGCT AACGGAA 50 Brain
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 1803 Intestine
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 119 Liver
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 87 Ovaries
fru-miR-462-5p GTAACGGAACCCATAATGCAGCT TAACGGA 19 Testes
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 85 Fast muscle
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 75 Slow muscle
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 131 Heart
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 97 Eye
fru-miR-101b-3p TACAGTACTATGATAACTGA ACAGTAC 106 Brain
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 72 Intestine
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 1774 Liver
fru-miR-101b-3p TACAGTACTATGATAACTGA ACAGTAC 24 Ovaries
fru-miR-101b-3p GTACAGTACTATGATAACTGA TACAGTA 15 Testes
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 1958 Fast muscle
fru-miR-133-3p TTTGGTCCCCTTCAACCAGCC TTGGTCC 785 Slow muscle
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 225 Heart
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 17 Eye
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 4 Brain
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 4 Intestine
fru-miR-133-3p TTTGGTCCCCTTCAACCAGCCG TTGGTCC 1 Liver
fru-miR-133-3p TTGGTCCCCTTCAACCAGCCGT TGGTCCC 6 Ovaries
  1. Bold indicates isomiRs with variation at the 5′ terminus