Skip to main content

Table 6 Description of primers used for qPCR validation of differential expression results

From: De novo assembly of a transcriptome from juvenile blue crabs (Callinectes sapidus) following exposure to surrogate Macondo crude oil

Gene (abbreviation) Trinity Component or Isoform ID Primer Name Sequence (5’ to 3’) Product Size (bp)
Heat Shock Protein 90 (hsp90) comp22653_c0a HSP90F2 CACCGACAACATCAAGCTGTAC 93
   HSP90R2 ACACCACGCACAAAGTTGAG  
EGL9 (egl9) comp25287_c2a EGL9F1 TGTTTTCGGCCTAAGTGGTG 111
   EGL9R1 AAATCCCGCACTATGCTTGG  
Hemocyanin comp16095_c0a HEMF1 TAACAAGAACCCGGGCAAAG 71
   HEMR1 AAATGAAGGTCCTGCTGGTG  
Ribosomal Protein L12 (rpl) comp18523_c0_seq1 RPNF2 AATCGCAGTTCATCCTCCAC 71
   RPNR2 GAGGCATGGTGCTGAATTTG  
Glutamate Oxyacetyl Transaminase 2 (got2) comp4115_c0_seq1 GOTF2 TTGAGATGATGGGCACTCAG 85
   GOTR2 TCTTTCAGCATCAGCACCAG  
Short-chain Dehydrogenase Reductase (sdr1) comp25500_c1_seq1 SDRF1 GTGCCGTAGTCATTATTCTCAGC 78
   SDRR1 TGTGGTGGTTTGACATGCAC  
sdr1-alternatively spliced variant (sdr1-ASV) comp25500_c1_seq2 SDRF3 CTTTCACTGCGACAAAAATCGG 136
   SDRR3 CCTTGTTAACGAACCACCACTG  
Glucuronosyltransferase (ugt1) comp16829_c0_seq2 UGTF2 AGCCAAGCAGGATGAGACTAAG 76
   UGTR2 TCTTGCATCAACACCAACGC  
ugt1-alternatively spliced variant (ugt1-ASV) comp19629_c0_seq1 UGTF3 CAGTGGATGTGCAAATAATCGTC 116
   UGTR3 TGGGGCATCAAAGTACTGGTAG  
  1. aComponent consists of multiple transcripts that are all amplified by the primer pair