Skip to main content

Table 4 Primers used for qRT-PCR validation of RNAseq data

From: Transcriptomic changes in the plant pathogenic fungus Rhizoctonia solani AG-3 in response to the antagonistic bacteria Serratia proteamaculans and Serratia plymuthica

Gene Id Putative function Forward primer Reverse primer Amplicon bp
1.t002520 aliphatic nitrilase GCGCGAACTTTGTGTCGATT AACGGCATTGACTTTGGGAG 100
15.t000002 endobeta xylanase GCGCGAACTTTGTGTCGATT AACGGCATTGACTTTGGGAG 122
1.t001237 dienelactone hydrolase CAGGAGACAATGCAGCTTGT ATCACAACGACGATGGCATG 139
4.t000274 isocitrate lyase GGGCTTTGTATGGCAGTTCA TAGTCGGCACCAGACCATTT 180
1.t002315 glycoside hydrolase family 61 protein CCTGGCACCGACAAAGTTT CGTGACGCATGATGTACTGG 150
6.t000086 haloalkanoic acid dehalogenase GCGAGAGAAAATGTGACTATTGG ACTCTGTCTCTGCTGCATCT 97
1.t000612 short chain dehydrogenase TCCAGAGATCGATTGCCTCC AAGGTGAACGAGGCCAGTAA 124
2.t000524 copper radical oxidase TGTTGCCTCTCTTCTTCCGT CAGTGTATGTCGGCCTTTCG 146