Skip to main content

Table 1 Families of interspersed DNA repeats identified in the L. incisa mitochondrial genome

From: The complete mitochondrial genome sequence of the green microalga Lobosphaera (Parietochloris) incisa reveals a new type of palindromic repetitive repeat

Repeat name # of copies Consensus sequencea Notes
LIMP 19 (AACCA) m [AATGAAA or TTTCATT](TGGTT) n Repetitive palindrome; 2 ≤ (m,n) ≤13
Repeat_2 16 GCCTGTACAAATCTCTGCCCAACCGTAATGAAATGGTTGGCAAAAGAAAAAGAAATGGTGAGAGTAATCAAATGGTTGGCTC Three copies interrupted by a LIMP; four copies next to LIMPs
Repeat_3 6 CCAGTTAAAATGAATGGCAAAAAACAAATGGTTGG  
Repeat_4 8 CTCCACACCATTTCATTAATCTCTGATTTGTTCA  
Repeat_5 7 TTTGGTTTGGTTTGGTTACAAATCAGAGAAAAGCAGGGGCTC Six copies overlapping LIMPs
Repeat_6 5 TTACGGTTGGGCAGAGAAAAAAGGCAACCGTGAAAAAAAAAGCTGCGGT three copies overlapping LIMPs
Repeat_7 5 AATCTCTGATTTGTTCAGGAACAACTGGTTGGG All copies adjacent to LIMPs
  1. apalindromic positions are underlined