Skip to main content

Table 2 Oligonucleotides used in this study

From: The impact of chromatin remodelling on cellulase expression in Trichoderma reesei

Name Sequence (5′ - 3′) Usage
RG53 GAATTCAGATC ivFP, oligo-short
RG54 GCGGTGACCCGGGAGATCTGAATTC ivFP, oligo-long
RG83 [6-FAM]CCTTTGGGTGTACATGTTTGTGCTCCGG ivFP, cbh1oligo3fw
RG84 [6-FAM]GGAGAGTGCAGGCCGACTGAGC ivFP, cbh1oligo3rev
RG89 [6-FAM]GTAGAGGCATGTTGTGAATCTGTGTCGGG ivFP, cbh1oligo3fw
RG90 [6-FAM]GGTTGTATGCAAAACGCTCCGAGTCAGAC ivFP, cbh1oligo3rev
actfw TGAGAGCGGTGGTATCCACG qPCR
actrev GGTACCACCAGACATGACAATGTTG
sar1fw TGGATCGTCAACTGGTTCTACGA
sar1rev GCATGTGTAGCAACGTGGTCTTT
cbh1f GATGATGACTACGCCAACATGCTG
cbh1r ACGGCACCGGGTGTGG
cbh2f CTATGCCGGACAGTTTGTGGTG
cbh2r GTCAGGCTCAATAACCAGGAGG
xyn1f CAGCTATTCGCCTTCCAACAC
xyn1r CAAAGTTGATGGGAGCAGAAG
taqxyn2f GGTCCAACTCGGGCAACTTT
taqxyn2r CCGAGAAGTTGATGACCTTGTTC
epiactinTr_f CTTCCCTCCTTTCCTCCCCCTCCAC act CHART, region −226 to +24
epiactinTr_r GCGACAGGTGCACGTACCCTCCATT
episar1Tr_f GTCAGGAAATGCCGCACAAGCAAGA sar1 CHART, region −490 to −224
episar1Tr_r TGTGTTTTACCGCCTTGGCCTTTGG
epicbh1_1Tr_f AAGGGAAACCACCGATAGCAGTGTC cbh1 CHART, region −902 to −610
epicbh1_1Tr_r TTTCACTTCACCGGAACAAACAAGC
epicbh1_2Tr_f GGATCGAACACACTGCTGCCTTTAC cbh1 CHART, region −301 to −27
epicbh1_2Tr_r GGTTTCTGTGCCTCAAAAGATGGTG
epicbh2_1Tr_f CGGATCTAGGGCAGACTGGGCATTG cbh2 CHART, region −587 to −338
epicbh2_1Tr_r GTGTAGTGTTGCGCTGCACCCTGAG
epicbh2_2Tr_f TGCAGCGCAACACTACACGCAACAT cbh2 CHART, region −355 to −62
epicbh2_2Tr_r TGCGCCTCATACAGGGTCACAGTCC
epixyn1_1Tr_f GCACTCCAAGGCCTTCTCCTGTACT xyn1 CHART, region −577 to −278
epixyn1_1Tr_r TAGATTGAACGCCACCCGCAATATC
epixyn1_3Tr_f GTCGATATTGCGGGTGGCGTTCAAT xyn1 CHART, region −306 to −10
epixyn1_3Tr_r TTTGTGCGTGTTTTCCTTGAAGTCG
epixyn2_1Tr_f GTGCCGATGAGACGCTGCTGAGAAA xyn2 CHART, region −527 to −252
epixyn2_1Tr_r GATATTGCGCCTTGCAACACCATCG
epixyn2_2Tr_f CTCGAGACGGCTGAGACAGCAGCAT xyn2 CHART, region −311 to −38
epixyn2_2Tr_r TGTCTTTTGGGCTTGGAGGGGTTGT