Skip to main content

Table 9 Conversion of SNP markers and InDel markers arising from marker mining on scaffold84773 into sequence-specific PCR markers in Lupinus angustifolius

From: Application of whole genome re-sequencing data in the development of diagnostic DNA markers tightly linked to a disease-resistance locus for marker-assisted selection in lupin (Lupinus angustifolius)

Marker name Primers Primer sequence (5′-3′)
SNP 20 SNP20F GTCCCTGCCATTATTAATAGTTACT
SNP20R CATCATGAGTCAATTTACCACTTA
SNP 25 SNP25F GTCACTAATTTTATCTTTGCAAGA
SNP25R GATCATAAGAATAATAATAATAATTTGGT
SNP 250 SNP250F GACTTAGTAATGTGCAACAAGAG
SNP250R CTGACACTACAGGTTCGCCT
SNP 263 SNP263F GGAACATTGTGATTCAGTCACC
SNP263R GATAGGTTTGTTGCAATAAGCG
SNP264 SNP264F GTTTCTTAGTTGCATAGTTGCAA
SNP264R CAAAACATTCATAAGTAACAAGG
SNP271 SNP271F CGACACCATCTGATATATGAAAATAA
SNP271R ACCGGAAATCTGTGTTTTTC
InDel2 InDel2F GATAAAGTATATCTAAATTATGTTTGC
InDel2R CTATATTTTGTATCAATTATAACAAATT
InDel10 InDel10F GTTAAGTGGTAAATTGACTCATG
InDel10R GTTTTRCATTCTTGCAAAGATAAAATTAG
InDel28 InDel28F CTACAATAGCCACACAAATAG
InDel28R GTTTAGATGGCCMTGTGC
InDel66 InDel66F CTTCTGAGTTGGACCATAAAC
InDel66R ACTCACATTTACAGAACTTTAACT