Skip to main content

Table 7 Primers used to confirm expression of unannotated transcripts. All PCRs were performed with an annealing temperature of 62°C and an elongation time of 30s

From: Generation of a de novo transcriptome from equine lamellar tissue

Name Forward Seq Reverse Seq Size
UN20159 TTCAAGAGCAATGGGATGCT CGCAGTGTCATGAACAGGTTA 227 bp
UN14299 TTTTCCTCTGAAGCATTTCC TAGAGCATCGCTTTCCTGGT 284 bp
UN30143 CCCACCCCCAACCTAGATAC AGGTAAGACAGGCTGGGTCA 499 bp
UN27297 GTCCGAATTCAGCCAATCAT GAAACGATTTATGGCCTCCA 495 bp
UN27113 TGAAAGGCATCCATCTGGTC ACCCCGTTACAGAGGTCCTT 329 bp
UN28086 TCCTTGCTAGGATGCTCTGG GAGCACCAGGATGAAGAGGA 506 bp
UN62514 GGCTCCTCCTCCTTGTGAG AACAGCAGTTTGGCAGGAGT 437 bp
UN21936 CTATGTTCTGGGCTGTGGTG TGTAGCCACGTTTGCACTCT 485 bp
UN70945 CCTCATGACCTTCGTGGTTC ATCTTTTTGAGCTGGCAAGG 409 bp
UN26965 GCACCCTACTCCCACATACG GCTCACATCCACGTCTGCTA 422 bp
UN26584 GTACATTCCTCCCCTGCAAA TCGACACCATCCAGTTGAAA 479 bp
UN50658 CTGACCAGGACCCTCAGTCT TCAGTGACCAGGCCTTCTTC 343 bp