Skip to main content

Table 1 Repeated regions of the DapuNPV

From: The genome of Dasychira pudibunda nucleopolyhedrovirus (DapuNPV) reveals novel genetic connection between baculoviruses infecting moths of the Lymantriidae family

Repeat region name Strict consensus nucleotide sequence Repeated element length Repeated element copiesa Location ORF
hr1, GCACCGCTAAAAATAGCACDCGCCTTTCGAGAGCGATCGCACCCGAAAAGCAGGGTCGTCGCTGAC 66 13 pe38 – ie2
hr2, 66 6 dapu023
hr3, 66 10 chit – lef7
hr4, 66 5 dapu077
hr5 66 4 dapu132
non-hr AAARTRATGAYTCATGYTADAKCAAGGTY 29 16 fgf – dapu136
A-C rich AMACAMACAMAC 12 16 p24 – gp64
  1. aevery truncated element was counted as one