Skip to main content

Table 2 Primer sequences used for qPCR

From: The impact of PPARα activation on whole genome gene expression in human precision cut liver slices

  Primer Sequence
Name Forward Reverse
36B4 CGGGAAGGCTGTGGTGCTG GTGAACACAAAGCCCACATTCC
ANGPTL4 CACAGCCTGCAGACACAACTC GGAGGCCAAACTGGCTTTGC
PLIN2 ATGGCATCCGTTGCAGTTGAT GATGGTCTTCACACCGTTCTC
PDK4 TGGAGCATTTCTCGCGCTAC ACAGGCAATTCTTGTCGCAAA
CPT1A TCCAGTTGGCTTATCGTGGTG CTAACGAGGGGTCGATCTTGG
VLDLR GGTGAAAATGATTGTGACAGTGG GTGAACTCGTCGGGACTACA