Skip to main content

Table 4 Known G. hirsutum miRNAs identified in each library

From: MicroRNA and mRNA expression profiling analysis revealed the regulation of plant height in Gossypium hirsutum

miRNA family miRNA miRNA sequence RPM Log2
A1 A9 A3 A1–A9 A3–A9
miR156 ghr-miR156a UGACAGAAGAGAGUGAGCAC 19.85 38.84 9.29 −0.97 −2.06
miR162 ghr-miR162a UCGAUAAACCUCUGCAUCCAG 1,830.80 364.61 126.20 2.33 −1.53
miR164 ghr-miR164a UGGAGAAGCAGGGCACGUGCA 937.47 261.57 37.59 1.84 −2.80
miR166 ghr-miR166a UCGGACCAGGCUUCAUUCCCC 143,209.00 199,713.00 57,708.00 −0.48 −1.79
miR167 ghr-miR167a UGAAGCUGCCAGCAUGAUCUA 127.99 47.78 12.16 1.42 −1.97
miR171 ghr-miR479 CGUGAUAUUGGUUCGGCUCAUC 4.73 0.01 0.01 8.88 0.00
miR2949 ghr-miR2949b UCUUUUGAACUGGAUUUGCCGA 14.18 5.94 1.11 1.25 −2.43
ghr-miR2949a-5p ACUUUUGAACUGGAUUUGCCGA 3,331.60 529.09 226.60 2.65 −1.22
  ghr-miR2949a-3p UGCAAAUCCAGUCAAAAGUUA 4.73 0.01 0.01 8.88 0.00
miR390 ghr-miR390a AAGCUCAGGAGGGAUAGCGCC 5,177.80 1,886.50 314.00 1.46 −2.59
miR393 ghr-miR393b-5p UCCAAAGGGAUCGCAUUGAUCU 13.71 1.59 1.99 3.11 0.33
miR394 ghr-miR394a UUGGCAUUCUGUCCACCUCC 1,387.00 340.84 95.08 2.02 −1.84
miR396 ghr-miR396a UUCCACAGCUUUCUUGAACUG 1,723.00 131.18 35.93 3.72 −1.87
miR399 ghr-miR399d UGCCAAAGGAGAUUUGCCCCG 326.08 35.67 17.69 3.19 −1.01
  ghr-miR399a UGCCAAAGGAGAUUUGCCCUG 127.59 0.01 9.95 13.64 9.96
miR482 ghr-miR482b UCUUGCCUACUCCACCCAUGCC 3,962.50 3,436.10 621.30 0.21 −2.47
  ghr-miR482a UCUUUCCUACUCCUCCCAUACC 5,487.80 1,597.20 556.10 1.78 −1.52
  ghr-miR2948-5p UGUGGGAGAGUUGGGCAAGAAU 1,984.80 499.36 1,00 1.99 1.00
miR827 ghr-miR827 UUAGAUGACCAUCAACAAACA 5,536.26 2,675.20 981.00 1.05 −1.45
miR3476 ghr-miR3476-5p UGAACUGGGUUUGUUGGCUGC 2,384.10 2,096.50 1.442.00 0.19 −0.54