Skip to main content

Table 2 List of differentially expressed miRNAs between WT and 7B-1 anthers

From: Identification of miRNAs with potential roles in regulation of anther development and male-sterility in 7B-1 male-sterile tomato mutant

miRNA Sequence Read counts Normalized expression DEa p-value
WT 7B-1 WT 7B-1 Log2(WT/7B-1)
miR390 AAGCTCAGGAGGGATAGCGCC 600 668 255.4 667.4 −1.3 0.003063
miR166 TCTCGGACCAGGCTTCATTCC 1731139 1537345 736984.2 1536039.9 −1.1 0.00993
miR159 TTTGGATTGAAGGGAGCTCTA 8237 7112 3506.7 7106.0 −1.0 0.016877
miR530 TGCATTTGCACCTGCACCTCC 290 50 123.5 50.0 1.0 0.022945
miR167 TGAAGCTGCCAGCATGATCTA 640 97 272.5 96.9 1.3 0.004468
miR164 TGGAGAAGCAGGGCACGTGCA 2898 466 1233.7 465.6 1.4 0.002397
miR396 TTCCACAGCTTTCTTGAACTG 2750 422 1170.7 421.6 1.4 0.002397
miR168 CCCGCCTTGCATCAACTGAAT 370 45 157.5 45.0 1.5 0.001237
miR393 ATCATGCTATCCCTTTGGACT 453 39 192.9 39.0 1.9 5.90E-05
miR8006 TAGTTTTTGGACTGCAGGGGCACC 855 34 364.0 34.0 2.8 <0.00001
  1. aDE is differential expression values which were calculated as log2-fold changes of the expression. Negative and positive values mean up- and down regulation of the expression in 7B-1, respectively. DE value of ±1 was considered as a cutoff value for significant changes of the expression