Identification of miRNAs with potential roles in regulation of anther development and male-sterility in 7B-1 male-sterile tomato mutant

Table 2 List of differentially expressed miRNAs between WT and 7B-1 anthers

miRNA	Sequence	Read counts		Normalized expression		DE^a	p-value
miRNA	Sequence	WT	7B-1	WT	7B-1	Log2(WT/7B-1)	p-value
miR390	AAGCTCAGGAGGGATAGCGCC	600	668	255.4	667.4	−1.3	0.003063
miR166	TCTCGGACCAGGCTTCATTCC	1731139	1537345	736984.2	1536039.9	−1.1	0.00993
miR159	TTTGGATTGAAGGGAGCTCTA	8237	7112	3506.7	7106.0	−1.0	0.016877
miR530	TGCATTTGCACCTGCACCTCC	290	50	123.5	50.0	1.0	0.022945
miR167	TGAAGCTGCCAGCATGATCTA	640	97	272.5	96.9	1.3	0.004468
miR164	TGGAGAAGCAGGGCACGTGCA	2898	466	1233.7	465.6	1.4	0.002397
miR396	TTCCACAGCTTTCTTGAACTG	2750	422	1170.7	421.6	1.4	0.002397
miR168	CCCGCCTTGCATCAACTGAAT	370	45	157.5	45.0	1.5	0.001237
miR393	ATCATGCTATCCCTTTGGACT	453	39	192.9	39.0	1.9	5.90E-05
miR8006	TAGTTTTTGGACTGCAGGGGCACC	855	34	364.0	34.0	2.8	<0.00001

^aDE is differential expression values which were calculated as log2-fold changes of the expression. Negative and positive values mean up- and down regulation of the expression in 7B-1, respectively. DE value of ±1 was considered as a cutoff value for significant changes of the expression

ISSN: 1471-2164