Skip to main content

Table 1 Primer sequences and primer positions based on TaEPSPS-7A1

From: Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

aPrimer No. Primer name bSequence (5' to 3') cGenome specificity Primer position
Forward     
- T7 TAATACGACTCACTATAGGG - -
1 F1.2 GCAATGGCGATGGCTG 7A 5'-UTR/exon 1
2 Int1_F2-D AGCAGCATGTCCTGTTATCTTAT 7D intron 1
3 Int1_F2-A/B CAGCATGTCCTGTTCTCTTG 4A intron 1
4 F2 AGGATGTCCACTACATGCTT 7A/7D exon 2
5 F3 AGGATGTCCACTACATGCTC 7D/4A/7A exon 2
6 F2-AB GCAACTTATGTGCTTGATGGC 7A exon 2/exon 3
7 InvF1-AB/D GAGCGACCTATTGGTGACTTAG 7D/7A/4A exon 3
8 InvF3-AB/D CCACCTGTCCGTATCAACG 7A/7D/4A exon 3
9 Int3_F1-AB ATGTAATGCAACCTTAGACCGC 7A intron 3
10 Int3_F1-A/B CGATCAATGCGACCTTACACAAT 4A intron 3
11 Int3_F1-D GCAACGCGACCTTACACCGT 7D intron 3
12 F19-AB GGACAGATTCTACATTAAGGGAGGAC 7D/7A/4A exon 4
13 Ex6_B-F TACTTGAGATGATGGGAGCG 4A exon 6
14 F13-AB ATTTGGAAGGAAACACCTAAAA 7A/4A exon 6
15 F14-D GAAGGAAACACTTAAAGGCTGTC 7D exon 6
16 F19-D GTCCTGACACTTGTTCATTC 7D/4A intron 6
17 F18-AB GAACATCACGGCGATCGAC 7A/4A exon 8
18 F18-D GAACGTCACGGCGATCGAT 7D exon 8
- TaSEC_F AGCAATTCGCACAATTATTACAAG - -
Reverse     
- SP6 TATTTAGGTGACACTATAG - -
19 InvR2-AB-D CAACAGGTTATCCACCACC common exon 2
20 InvR1-AB-D GCATTGCAGTTCCAGCATTAC common exon 2
21 R1-AB TTGTGCCAAGGAAACAATCGA 7A exon 3
22 Ex4_R2 GCTCCGCAGTCACACCAAAAT 7A exon 4
23 R2 TCAGAATGCTCCGCAGTCACA 7A/7D exon 4
24 R3 TCAGAATGCGCCGCAGTCACG 7D/4A exon 4
25 Ex4_R3 CTTGTATTTTTGTCCTCCCTTG 4A exon 4
26 R19-AB CCAGAATAATGGATGGCTCG 7A intron 4
27 Ex6_B-R1 GCAACAACGGCAAGAGTCATT 4A exon 6
28 R18-D GACGCACGTGCTAGATTGCTTG 7D intron 6
29 R12-AB CGGATCGCGACCATTCTTTCA 7A exon 7
30 R16-AB TCTTTCGGGTGCATCCAGGG 7A exon 8
31 R16-D TCTTTCTGGTGCACCCCGGA 7D exon 8
32 R1 CTAGTTCTTGACGAAGGTGCTTAG common exon 8
- TaSEC_R CTCACAGAAGACCTGGAAGC - -
  1. aPrimers are numbered in order based on location in TaEPSPS-7A1 as shown in Additional file 4
  2. bThe start codon ATG and stop codon CTA are underlined
  3. cBold letters indicate genome-specific primers