Skip to main content

Advertisement

Table 2 Primers used in QPCR studies

From: Transcriptome profiling reveals that feeding wild zooplankton to larval Atlantic cod (Gadus morhua) influences suites of genes involved in oxidation-reduction, mitosis, and selenium homeostasis

Gene name Primer name Nucleotide sequence (5′-3′) Efficiency (%)a Amplicon size (bp)
coagulation factor V 36536-1F GGGAACACGGATAACAATGG 103.4 132
36536-1R AAAGTCACAGCCGAGCAACT
dehydrogenase/reductase SDR family member 1 36829-1F GTCTTGATGACCTGCGACCT 85.0 110
36829-1R AGGTAAGGGACCTGGGACAC
glutathione peroxidase 1b 37395-2F TGCTTCAGAAGTCGGATGTG 101.6 135
37395-2R AGACTGGGCTCCAGATGATG
cytochrome P450 CYP2Y3 37900-2F CAGGAACGGAGACAACCAGT 105.0 109
37900-2R ACCCAATGACAGAGGCAATC
microsomal glutathione S-transferase 3 38166-1F TGATCGCCATGGATATGCTA 104.0 113
38166-1R TGCACCCCCAACTTTTACTC
peroxiredoxin-1 (alias natural killer enhancing factor) 39283-1F GTGCTTTCAGAGGGCTGTTC 100.7 146
39283-1R GCACACTTCCCCGTATTTGT
DNA-damage-inducible transcript 4 (alias REDD1) 41986-1F ACTGCTCACGTCACAAGGTG 99.7 118
41986-1R GTTCCTAACGACGCTTCTGC
selenoprotein Pa 42046-1F GGGCAGGGTCATGTAGAGAA 101.5 116
42046-1R CTGGTCACTACTGGCCTGGT
solute carrier family 6, member 6 42481-2F GTCTGAGGGACCTCTGATCG 101.4 102
42481-2R AGCTCGCTGTCCTTCACAAT
thioredoxin-interacting protein 42540-2F GGCGATGACGAAGTGTGTAA 91.7 111
42540-2R TGGCTCACCTCCACGATTAT
trypsinogen H1_3a1 42811-2F GACGCTGGACTACGACATCA 81.4 124
42811-2R TCCAGACACGACACACTGGT
aurora kinase B 42084-2F AGCCACTCGGAGACGTACAC 97.6 89
42084-2R TTGGAGATCAGGTCCTTTGC
nattectin precursor 46230-1F GGCATTGAGGCAGATAGAGG 98.9 150
46230-1R TCAGACTGTGGGTCTTGCAG
ferritin, middle subunit 37201-1F TGGCTTGGATTCCATAAAGC 107.7 102
37201-1R GGTCAAAAGTGCTCCGTCAT
RNA polymerase II elongation factor ELL2 41953-2F GCTTCCGCATAAAGACAAGG 93.8 150
41953-2R GGATAACAGCGGCGTGTACT
  1. aAmplification efficiencies were calculated using a 5-point 1:3 dilution series starting with cDNA representing 10 ng of input RNA. See Methods for additional details