Skip to main content

Table 3 Oligonucleotide primers used for qRT-PCR

From: Genomic mutational analysis of the impact of the classical strain improvement program on β–lactam producing Penicillium chrysogenum

Primer name Gene Sequence 5′-3′
PKS1F Pc12g05590 GCTACAGCCCTGACGCCATGG
PKS1R Pc12g05590 CTGCGCAGGTCTACATCGGTACC
PKS2F Pc13g04470 CCGAAGATGCCGGCGACGG
PKS2R Pc13g04470 CGCTGGTCTGCGATGTGGCC
PKS3F Pc13g08690 CGAGAGACCAGGATAAGGTTCTTGGC
PKS3R Pc13g08690 GGTGGTCTGTCACCACTCTTCCC
PKS4F Pc16g00370 CATGGTCAGCACCCTCAGTGCC
PKS4R Pc16g00370 CCAGGTCAGGCGTCGTACGC
PKS5F Pc16g03800 CGGGTGCTGCATAGATGTACTACGC
PKS5R Pc16g03800 GCTGGCCACGGAAGACAACGC
PKS6F Pc16g04890 CCTATTCGCGCCCTGATTATGGGC
PKS6R Pc16g04890 CGAGATTTGTCTTCACAGAACCCACC
PKS7F Pc16g11480 CACGATTTTAGCAAGTCAACCAGCGCG
PKS7R Pc16g11480 CTCGCTCTCCCAGAATGTCAAGGC
PKS8F Pc21g00960 GCCACACTCATCGGCACCACG
PKS8R Pc21g00960 GCTCCACAGAGCAACCAACCCG
PKS9F Pc21g03930 GACGTGGCCGGTGATGCCG
PKS9R Pc21g03930 GCGATGTTGCGGACGAGGCC
PKS10F Pc21g03990 CAGCGCCGAGTCCTACAGCC
PKS10R Pc21g03990 GTGGACCTTGGAGGATGTCTTGC
PKS11F Pc21g04840 CCTTGACGAATATCCGCACTCCG
PKS11R Pc21g04840 CAAGCCACAGCTGATGAAGCGC
PKS12F Pc21g05070 GTCGGAGGCAATTCGGGAAGGC
PKS12R Pc21g05070 GCAAAGTTCCACCACAATGCCGCG
PKS13F Pc21g05080 CCGAGGATCTCCGCCAGGC
PKS13R Pc21g05080 GGTTGTGCAGGTTCCAGGTGCC
PKS14F Pc21g12440 GCACCACCATCAGCCAAAGCATACC
PKS14R Pc21g12440 CCGAGGTCCATTGGAACTATGCGC
PKS15F Pc21g12450 CCAGTTGTCTGCAGCCGGCC
PKS15R Pc21g12450 GCCCAGATCACCGCCGTACG
PKS16F Pc21g15160 CAGCCGCGTAGTTTGCCTGGC
PKS16R Pc21g15160 GCACAGTGTGCTGAGGTTACGGC
PKS17F Pc21g16000 CTTGTCATCAGCAGCCCAGAGG
PKS17R Pc21g16000 CAATTTGCGGTGGCTGAGACGC
PKS18F Pc22g08170 GGTTGATACTCCTGGGACTGAATACAG
PKS18R Pc22g08170 GCTGCTGTGGATCCATCTGCTCG
PKS19F Pc22g22850 CGGTCAACCAGGGATCCAACTGC
PKS19R Pc22g22850 CTGAAGCGGTCTCTGTGTGGCC
PKS20F Pc22g23750 CGGTAATGTCCAGCTGGCACTCG
PKS20R Pc22g23750 CTTCAGGCACTTCTGTACCGGG
NRPS1F Pc13g05250 GCAGACCTGTATCCATCGCAA
NRPS1R Pc13g05250 GGAGGCAAGTGAAGGTGTGTT
NRPS2F Pc13g14330 GCGACAGCCGCCGGAGTAACTATGG
NRPS2R Pc13g14330 GAGAGACGGGGACACGCGTGATG
NRPS3F Pc14g00080 ACGTACGCTCGAGCTGGACT
NRPS3R Pc14g00080 GCCGTCGCGTTGATAATTGG
NRPS4F Pc16g03850 TGGTTGAAAGAGGGCAGTCTC
NRPS4R Pc16g03850 CGCGAACATACACAACACCAC
NRPS5F Pc16g04690 CTTTCCAGAACAGTTGGCTGGT
NRPS5R Pc16g04690 GCTGCATCTTACCCAGGTAATTG
NRPS6F Pc16g13930 CCACCCTTGTTCAGCCGCTGAATTCC
NRPS6R Pc16g13930 GGACGAGGCGAACAACATCGGAC
NRPS7F Pc21g01710 GCTATCTCGGTGGAGGATCTTCTGTCC
NRPS7R Pc21g01710 GTGCTGCTGAGAACACGGGATTGT
NRPS8F Pc21g10790 GTGAGGCAGCTTTGTTCAACACCATT
NRPS8R Pc21g10790 TTCTGCAGCAGGCTGTCGGCCTGAG
NRPS9F Pc21g12630 GAGCCAACTCTGTTGTCTACG
NRPS9R Pc21g12630 CAGGGCAATTTGCCTCATTCTG
NRPS10F Pc21g15480 CTTGGTGGATGCAGCGAAGG
NRPS10R Pc21g15480 CTGTGAGAGAGGCTCTTGAGTA
NRPS11F Pc22g20400 TTCGCGAACATCCGAAGAAGC
NRPS11R Pc22g20400 TCGGGCGAAGACACTGTTCA
pcbAB F Pc21g21390 CACTTGACGTTGCGCACCGGTC
pcbAB R Pc21g21390 CTGGTGGGTGAGAACCTGACAG
12.10 F Pc21g05010 GATGCTTTCTTGAATAGCGGATCCACG
12.10R Pc21g05010 GAACTTTGCGTTGATCGACTATTTCCACG
12.20 F Pc21g05020 CTTAACATCTCCGATTCCCTACTCGG
12.20R Pc21g05020 CAACCAATCCTGCGATCCATCCTCC
12.30 F Pc21g05030 GGATAGCCAGAGAGTCAGAGAGACC
12.30R Pc21g05030 GCGGACGGCAAGACTCAAGGCGCCTCC
12.40 F Pc21g05040 GGAGAAAGCACGGCAATCGATAGTGG
12.40R Pc21g05040 CCTATTCCTGTGCATGATTCTCGGCG
12.50 F Pc21g05050 GAAGCGTGGATAGAGACCGAAGAGAAC
12.50R Pc21g05050 GGAGCCAGACTCCGGAAAGGATACTG
12.60 F Pc21g05060 GATAGTGAGTACAAATGCGCCTGGACC
12.60R Pc21g05060 CGTTCAATACCGGAAATGGCTAGATTCG
12.90 F Pc21g05090 CGTTAACTAATGACGCCACCTGTTGC
12.90R Pc21g05090 GGAAAATAGTATCCCCAGCGATTGGC
12.100 F Pc21g05100 CATCAGCACCGAGGTCTTCATTGTCG
12.100R Pc21g05100 GCAACGCAATAGATGGTCAATGCCAG
12.110 F Pc21g05110 CTGCAGCACTTCAGCATGGATGAAACC
12.110R Pc21g05110 TCGTTGTGAGACTTGGATGCTCGGACG
12.120 F Pc21g05120 CCTGCTTCTTAATCTTGCCCTGGC
12.120R Pc21g05120 CCAAGCCGATGCCAAGAAGGAAGAG
12.130 F Pc21g05130 CCTAAGTCCTTGATCAGAGCCTGG
12.130R Pc21g05130 GTTGAGGTCGATACCCGTAAGTCATCC
\