Skip to main content

Advertisement

Table 2 Identified small RNAs. Mito and TC refer to the mitochondrial-enriched and total-cellular libraries, respectively

From: High transcript abundance, RNA editing, and small RNAs in intergenic regions within the massive mitochondrial genome of the angiosperm Silene noctiflora

Chrom Start End Length (bp) Strand Reads counts  
Mito 1 Mito 2 TC 1 TC 2 Sequence
5 41506 41527 22 - 200 235 227 215 CAATTCCTTTGAGTTTCATTCT
5 85989 86005 17 + 688 750 23 14 GTGGCTGGATTGAATCC
8 138948 138969 22 + 42 101 9 4 ACAAGGAGGAAAAGATCTATCT
20 33127 33145 19 - 561 622 822 495 AGAGGTGAAATAGAATAAC
25 85974 85990 17 - 157 247 550 517 GTTTTCATGAGGCTGAT
28 110134 110152 19 - 133 122 206 215 CCTCTCAAGTCATTTCACA
45 49949 49971 23 - 483 411 76 60 CGGCACGAGCTGACGACAGCCAT
48 74534 74551 18 + 48 69 194 366 GAATCCGGGCCAGAAGCG
49 21331 21347 17 + 55 63 20 24 AGTCAGAATCCGGGCCA