Skip to main content

Table 5 List of SNP markers associated with GLS resistance and informative in marker-assisted selection

From: Combining powers of linkage and association mapping for precise dissection of QTL controlling resistance to gray leaf spot disease in maize (Zea mays L.)

QTL Name SNP marker name Sequence with the source of variationa MAFb Physical position
QTLGLSchr1 PZE-101188909 TTCAGGGTGCTGATTTATTTTTCCGGGCAGTAATCTCGAACATGGAAAAG[A/G]TTTATTTGAGCAGGAATCCTACAGCCAAAACCATTCTGGAGCTTGTACGA 0.23 234,309,200
QTLGLSchr6 none    
QTLGLSchr8a PZE-108022834 CGCCGATGGATGGATAGACAGCAAATTCCGGTGAGCACATCGATCCGTTT[T/C]ATTCCATGCGCCGATCGATGCATATAGGTGCATGAAAACTTAATTACTCA 0.26 21,810,604
QTLGLSchr8b PZE-108050268 AAAGCCAGCATACCAGTAGCACTAGTGAGTTAACCCCCCTGAAATTCTGC[A/T]GCAGCAGCAGTCTGGATCGCAGTCACCATGTCACCAGCCACCAGGGCATC 0.09 87,682,262
  1. aContext sequence from which Infinium assay was designed. Single nucleotide polymorphism is shown in square brackets with putative GLS resistance allele underlined and bolded. Oligos for Infinium assay design were not included as they would always be de novo designed for any new order
  2. bMinor allele frequency