Skip to main content

Table 1 Primer sets used in qPCR reactions for validation of the RNA-Seq analysis

From: Comparative transcriptome analysis of lufenuron-resistant and susceptible strains of Spodoptera frugiperda (Lepidoptera: Noctuidae)

Transcript   Sequence (5′- 3′)
L_464_T_3/3 Forward CAATGCAATTCCTTGGACCAA
Reverse GCACACCATCGATCCAATGA
L_406_T_12/23 Forward TCGGTGAGAGGTATGCCAAAT
Reverse AAGTTTCGCAAGACGTGCACTA
L_669_T_9/12 Forward CAAACCAGCCTGCACCTGTA
Reverse GGGCAACAGGACGTGTATAGG
L_1141_T_4/4 Forward CCATCGAGGTTGTGCAAAAA
Reverse CCTCAGCCAGTGTCCTCCAT
L_1141_T_1/4 Forward CAATCCGCTCGCGTACATG
Reverse AATCTTGACCCAATGCAATTCC
GAPDH Forward CGGTGTCTTCACAACCACAG
Reverse TTGACACCAACGACGAACAT
\