Skip to main content

Table 2 Targets of conserved and other known miRNAs in Nicotiana benthamiana a

From: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

miRNA family miRNA sequence Gene ID Clevage position Category Normalized abundancea Annotation
Conserved miRNAs and their targets
Nb_miR156 TGACAGAAGAGAGTGAGCAC comp77119_c0_seq6 2667_2942 1787 0 2,40 Squamosa promoter-binding-like protein 6
Nb_miR156 TGACAGAAGAGAGTGAGCAC comp69399_c0_seq4 393_944 650 2 1,28 Squamosa promoter-binding-like protein 16
Nb_miR159 TTTGGATTGAAGGGAGCTCTA comp71582_c0_seq2 1_1230 673 0 40,63 No annotationb
Nb_miR159 TTTGGATTGAAGGGAGCTCTA comp69815_c0_seq4 1_894 601 0 0,39 Transcription factor GAMYB
Nb_miR159 TTTGGATTGAAGGGAGCTCTA comp73942_c0_seq1 927_2375 1839 0 2,14 Transcription factor GAMYB
Nb_miR160 TGCCTGGCTCCCTGTATGCCA comp78286_c0_seq3 693_2783 2065 0 307,20 Auxin response factor 18
Nb_miR160 TGCCTGGCTCCCTGTATGCCA comp79462_c0_seq1 2477_3379 2658 0 6,41 Auxin response factor 16
Nb_miR164 TGGAGAAGCAGGGCACGTGCA comp72325_c0_seq2 310_1305 994 0 3,43 Protein CUP-SHAPED COTYLEDON 2
Nb_miR165/166 TCGGACCAGGCTTCATTCCCC comp80060_c0_seq5 1298_3817 1868 0 51,20 Homeobox-leucine zipper protein REVOLUTA
Nb_miR165/166 TCGGACCAGGCTTCATTCCTC comp79517_c0_seq6 1043_3556 1601 0 246,61 Homeobox-leucine zipper protein ATHB-15
Nb_miR165/166 TCGGACCAGGCTTCATTCCTC comp79347_c3_seq8 336_611 546 1 1,60 No annotationb
Nb_miR167 AGATCATGTGGTAGCTTCACC comp79742_c0_seq4 124_2421 1700 2 5,90 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferaseb
Nb_miR167 AGATCATGTGGTAGCTTCACC comp74516_c0_seq2 292_2619 1160 2 3,54 Subtilisin-like proteaseb
Nb_miR168 TCGCTTGGTGCAGGTCGGGACC comp79927_c1_seq7 1_243 876   1,60 Protein argonaute 1A
Nb_miR169 TAGCCAAGGATGACTTGCCT comp72459_c1_seq2 1230_1673 1724 2 0,19 Nuclear transcription factor Y subunit A-5/CCAAT-binding transcription factor
Nb_miR169 TAGCCAAGGATGACTTGCCT comp72338_c0_seq4 1046_1396 1439 2 0,29 Nuclear transcription factor Y subunit A-5/CCAAT-binding transcription factor
Nb_miR169 TAGCCAAGGATGACTTGCCT comp73705_c1_seq8 1254_1739 1836 1 3,15 Nuclear transcription factor Y subunit A-8/CCAAT-binding transcription factor
Nb_miR169 TAGCCAAGGATGACTTGCCT comp67524_c0_seq9 544_1167 1246 0 1,96 Nuclear transcription factor Y subunit A-10/CCAAT-binding transcription factor
Nb_miR171 TTGAGCCGCGCCAATATCACG comp76988_c0_seq2 277_1911 896 0 26,05 Scarecrow-like protein 15
Nb_miR171 TTGAGTCGCGCCAATATCACT comp80119_c0_seq4 672_2573 1552 0 34,34 Scarecrow-like protein 6
Nb_miR171 TTGAGTCGCGCCAATATCACT comp75200_c0_seq2 459_2717 1696 0 109,89 Scarecrow-like protein 6
Nb_miR172 AGAATCTTGATGATGCTGCAG comp78340_c2_seq4 552_1409 2200 0 4,42 Floral homeotic protein APETALA 2
Nb_miR319 TTGGACTGAAGGGAGCTCCCT comp68096_c0_seq1 79_1191 1046 0 1,02 Transcription factor TCP4
Nb_miR319 TTGGACTGAAGGGAGCTCCCT comp73714_c2_seq12 2093_2317 2006   0,98 Transcription factor TCP2
Nb_miR393 TCCAAAGGGATCGCATTGATCC comp80206_c0_seq2 468_4724 4235 2 0,29 No annotationb
Nb_miR394 TTGGCATTCTGTCCACCTCC comp60101_c0_seq1 5351_5605 5291 2 2,16 Tripeptidyl-peptidase 2b
Nb_miR395 CTGAAGTGTTTGGGGGAACTC comp75863_c0_seq1 200_1609 553 2 0,53 ATP sulfurylase 1, chloroplastic
Nb_miR395 CTGAAGTGTTTGGGGGAACTC comp29318_c1_seq1 108_620 254 0 1,07 Sulfate transporter 2.1
Nb_miR396 TTCCACATCTTTCTTGAACTG comp71133_c0_seq1 1089_1355 935 2 2,10 Protein THYLAKOID FORMATION1, chloroplasticb
Nb_miR396 TTCCACAGCTTTCTTGAACTG comp77639_c0_seq4 942_2765 1723 0 4,42 Growth-regulating factor 6
Nb_miR396 TTCCACAGCTTTCTTGAACTG comp67678_c0_seq1 205_573 279 0 12,19 Thioredoxin H-type 1b
Nb_miR396 TTCCACAGCTTTCTTGAACTG comp50987_c1_seq1 2_379 144 1 0,48 40S ribosomal protein S15b
Nb_miR396 TTACACAGCTTTCTTGAACTG comp69468_c0_seq1 204_1724 1425 2 0,58 Protein IQ-DOMAIN 14b
Nb_miR396 TTCCACAGCTTTCTTGAACTG comp77795_c0_seq2 2_1780 1546   0,58 Pentatricopeptide repeat-containing protein At5g04810, chloroplasticb
Nb_miR396c TTCCACAGCTTTCTTGAACTG comp77334_c1_seq28 1342_2196 1370 0 3,74 Growth-regulating factor 5
Nb_miR396 TTCCACAGCTTTCTTAAACTG comp79406_c0_seq1 393_3506 1932 2 0,29 No annotationb
Nb_miR396 TTCCACAGCTTTCTTGAACTG comp76253_c0_seq1 643_1557 767 0 0,19 Growth-regulating factor 9
Nb_miR396 TTCCACAGCTTTCTTGGACTG comp69128_c0_seq2 114_806 521 2 0,19 DNA-directed RNA polymerase V subunit 5A-l ikeb
Nb_miR397 TCATTGAGTGCAGCGTTGATG comp73318_c2_seq1 87_1109 883 2 4,42 Glyceraldehyde-3-phosphate dehydrogenase, cytosolicb
Nb_miR397 TCATTGAGTGCAGCGTTGATG comp75344_c1_seq2 127_1839 810 2 0,24 Laccase-7
Nb_miR397 TCATTGAGTGCAGCGTTGATG comp77652_c0_seq1 1261_3177 176 2 0,29 Probable serine/threonine-protein kinase abkCb
Nb_miR398 TATGTTCTCAGGTCGCCCCTG comp100607_c0_seq1 102_557 78 0 9,46 Umecyanin
Nb_miR408 TGCACTGCCTCTTCCCTGGCT comp85708_c0_seq1 121_624 630 0 15,30 Uclacyanin-2
Nb_miR408 TGCACTGCCTCTTCCCTGGCT comp79061_c1_seq3 184_1473 2346 0 12,38 Copper-transporting ATPase PAA2, chloroplastic
Other known miRNAs and their targets       
Nb_miR482 TTCCAATTCCACCCATTCCTA comp75828_c0_seq3 249_1742 1609 2 1,07 No annotationb
Nb_miR827 TTAGATGAACATCAACAAACT comp75426_c0_seq1 2_226 1982 2 1,36 UPF0496 protein 4
Nb_miR4376 TACGCAGGAGAGATGATACTG comp79500_c0_seq4 305_3562 284 2 0,98 Calcium-transporting ATPase 8, plasma membrane-type
Nb_miR6020 AAATGTTCTTCGAGTATCTTC comp70698_c0_seq1 752_1555 996 1 0,68 GPN-loop GTPase 3 homologb
Nb_miR6020 AAATGTTCTTCGAGTATCTTC comp74553_c0_seq5 265_702 596 0 1,47 No annotationb
Nb_miR6020 AAATGTTCTTCGAGTATCTTC comp75715_c0_seq5 271_2055 1544 2 0,27 Probable methylenetetrahydrofolate reductaseb
Nb_miR6149 TTGATACGCACCTGAATCGGG comp80883_c0_seq1 2_310 14 2 0,27 Tubulin alpha chainb
Nb_miR6149 TTGATACGCACCTGAATCGGG comp75221_c0_seq2 455_1678 1646 2 1,77 Serine/threonine-protein kinase HT1b
Nb_miR6151 TGAGTGTGAGGCGTTGGATTGA comp84169_c0_seq1 105_1127 334 2 2,10 Probable carboxylesterase 8b
Nb_miR6157 TGGTAGACGTAGGATTTGAAA comp66224_c0_seq2 136_780 259   0,68 Ras-related protein RABA2bb
Nb miR6161 TGCTGGACCGACATACTTTGT comp74264_c0_seq1 147_1052 343 2 0,48 60S ribosomal protein L5b
  1. a The abundance for the degradome fragment (tag) indicating cleavage at that position/total number of fragments x 1,000,000
  2. b New target in N. benthamiana for conserved and other known miRNAs