Skip to main content

Table 1 The potential novel miRNAs and their targets

From: MicroRNA-mediated susceptible poplar gene expression regulation associated with the infection of virulent Melampsora larici-populina

miRNA Targets
miRNA log2 Sequences (5′-3′) Annomination log2
PC-5p-310376_3 12.64 UUUUCAAUAAUUGCAUCAAUA NB-ARC domain-containing disease resistance protein −0.37
PC-3p-1638036_1 11.06 UUUGAUAGAACCACUGCA xyloglucan endotransglucosylase/hydrolase 28 0.38
PC-5p-674947_1 11.06 GCAGUGACUUGAAAGAA RING-box 1 −0.00
PC-3p-2607690_1 2.77 CGGCAACGGAAUUUAUUUUAUU E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 family protein 0.03
PC-5p-236891_4 2.27 UCUCAACGAAACUUCAAUCGU Sec23/s protein transport family protein −0.23
PC-3p-142486_6 1.77 UUACACAGAACCAUGCC Golgi nucleotide sugar transporter 4 0.17
PC-3p-2198351_1 1.18 ACUCGUGAUUUUAACAACCUUGGU RING/FYVE/PHD-type zinc finger family protein −0.14
PC-3p-390998_2 1.18 CUGGCAGGGAUUGUAACUGUG HXXXD-type acyl-transferase family protein 0.14
PC-3p-1014196_1 1.18 CAAAGAAGCUGCAAUUUGAAA LRR and NB-ARC domains-containing disease resistance protein −0.54
PC-5p-86003_12 1.18 CUUCUCCAUGGAGUGCAUG Ferritin 2 −0.49
PC-3p-193248_4 1.03 CCUGGACACUGUUCACU Polyketide cyclase/dehydrase and lipid transport superfamily protein 0.08
PC-5p-275646_3 −1.14 CGAAGAGUUCUUGGUGUUUU Preprotein translocase SecA family protein −0.70
PC-5p-336387_2 −1.40 GUAGUUCUUUCCCAUCAAACC Phosphoglycerate kinase 1 −0.09
PC-3p-123255_8 −1.40 AAAUUGAUGAAUUUAUGGAGU WRKY DNA-binding protein 3 0.06
PC-3p-401772_2 −1.40 UUGAGAUUGUAGUAGCAGUGAU Jasmonate-zim-domain protein 1 −1.29
PC-3p-1525453_1 −10.88 CUGCCCUCGAGAGACUC Multidrug resistance-associated protein 6 0.14
PC-3p-2241919_1 −10.88 UGUGUUGUAGUAAUUACU Chaperone protein htpG family protein −1.10
PC-5p-1903277_1 0.18 ATGTTATGTGGTAGATAA Aldehyde dehydrogenase 3H1 −1.02
PC-3p-1909651_1 −9.88 ACTCATAATGTTGCAAC Glutathione S-transferase 6 0.54
PC-5p-359200_2 −10.88 TTACTCGATAATGATATGAAC Cysteine-rich RLK (RECEPTOR-like protein kinase) 25 1.23
PC-5p-2592253_1 −10.88 AGATAAATCCAACGATACCAAAAA Cysteine-rich RLK (RECEPTOR-like protein kinase) 42 1.02
PC-5p-1977684_1 −9.88 ATTCCACTGATTTCTTTTATGATG Cysteine-rich RLK (RECEPTOR-like protein kinase) 26 1.12
PC-3p-719252_1 −9.88 GTTTAATTTCACACACACACACAC Cysteine-rich RLK (RECEPTOR-like protein kinase) 26 1.00
PC-5p-1490392_1 −9.88 TTTGTGAATTCCAAAAGTGGT Cysteine-rich RLK (RECEPTOR-like protein kinase) 29 1.13
PC-5p-1501811_1 −9.88 ATTCCCTCGATATATACCGATAGA Cysteine-rich RLK (RECEPTOR-like protein kinase) 34 1.81
PC-3p-2480743_1 0.18 GAAGTGATCAACATAGAAATGATTT Cysteine-rich RLK (RECEPTOR-like protein kinase) 42 8.64
PC-5p-1349045_1 −9.88 CATTTGTTCATGCTTCTTA Disease resistance protein (CC-NBS-LRR class) family −0.08
PC-5p-1150271_1 10.06 TTGAATTAGAGAAATTAGGGT SID2 −0.19
PC-5p-1312398_1 −10.88 TGCCCCTTGAATGCCATTCTT OPR3 0.92
PC-3p-272434_3 −1.82 AGACACACCAAAACTTCAATGATG MPK4 −0.19