Skip to main content

Table 1 Sequence motifs identified in regulatory regions of the genes differentially expressed in the rosR mutant and the wild-type strain, which show a significant similarity to the RosR-box sequence

From: Transcriptome profiling of a Rhizobium leguminosarum bv. trifolii rosR mutant reveals the role of the transcriptional regulator RosR in motility, synthesis of cell-surface components, and other cellular processes

Gene Putative function of encoded protein product COG Log2 fold change Sequence motif (5’-3’)a Identity (%) Distance to translation start site (nt)
Rt617_78 Amino acid ABC transporter substrate-binding protein E 5.097 TGAAATCCATATCGACACTTCT 72.2 0
Rt620_77 Urea ABC transporter ATP-binding protein E 3.502 CGGCTTCAAGGCGCTGAATTCG 66.7 61
Rt619_162 ABC-type dipeptide/oligopeptide transport system, permease EP −4.011 CAGAATCCGGCGGTGC-TTCCG 68.2 −153
Rt619_164 Peptide ABC transporter ATPase EP −4.438 CGCATTCTTCTCCTCTATATCG 66.7 −281
Rt648_25 LacI family transcriptional regulator G 3.147 CGGCGGATAATCCTTGATCTCG 66.7 −176
Rt794_16 ABC transporter ATP-binding protein G 2.968 GCGCTTCGTGGCGTGGATTTCG 66.7 56
Rt794_99 Sugar ABC transporter G 2.053 CGGATTCCAGTAGGGATTTTCG 72.2 85
Rt643_15 Sugar ABC transporter substrate-binding protein G −3.744 CGGGGTCAGCAACTGCATTTCG 72.2 −83
Rt620_14 Glycerol 3-phosphate ABC transporter G 2.133 CGAAATTTCTCTAAATATTTCC 66.7 −174
Rt657_260 Cell division protein FtsK D −3.211 CGGCGTCGAGATCTCGACATCG 66.7 −216
Rt634_26 Flagellar biosynthesis repressor FlbT N −3.247 CGCAAGGTCGCGCTGGAATTCC 66.7 74
Rt634_27 Flagellar basal body rod modification protein FlgD N −3.391 CAGAAGGCAACGCTGAATTACG 66.7 65
Rt634_13 Flagellin B N −4.601 TCCGATCTCGATTTAGCTTTCT 66.7 −170
Rt634_5 Flagellar basal body P-ring biosynthesis protein FlgA N −3.438 GGAAATCACCGAGCTGATCTCG 59.1 −99
Rt628_11 Flagellar motor switch protein FliN NU −4.579 CCGGCTGCGGGCATGGATTTCG 66.7 −13
Rt761_94 Methyl-accepting chemotaxis protein NT −3.966 CGCAAACGCAGTGTGTATTTGA 54.5 −124
Rt628_20 Chemotaxis protein CheD NT −2.353 CGAATTGGAAGATTGGCTGTCG 66.7 145
Rt792_47 Chemotaxis protein NT −2.587 CGGAATGCAGCTATCCATTCCC 66.7 −36
Rt647_8 Chemotaxis protein NT −3.651 TAAATTCTACGCCAAGATCGCC 66.7 127
Rt628_24 Chemotaxis protein CheW NT −3.050 CGGAGTCCAGCCCGGATTTCG 72.7 98
Rt628_25 Chemotaxis protein CheA NT −2.793 CGGAGTCCAGCCCCGGATTTCG 72.7 98
Rt792_70 Chemotaxis protein NT −3.025 CGGATGACATCAGAGGATTTCG 72.2 −298
Rt628_22 Chemotaxis protein CheB NT −3.030 CGGCGTCTATGAATGGGTGGAG 66.7 −40
Rt620_4 Glycosyl transferase M 5.444 CGAATACCAAAGCCTGATTTCG 66.7 −76
Rt620_5 Polysaccharide biosynthesis protein M 5.090 CTGGCGCGACTGCTCGATTTCG 66.7 59
Rt794_35 Polysaccharide biosynthesis protein M 2.433 CGGCATCGGCCGGTAGATGACG 66.7 −191
Rt768_57 Peptidoglycan hydrolase M −2.657 CCGCATCGGCACGATGATTTCG 66.7 −243
Rt679_3 Glycosyl transferase M −3.806 CCGATTCACTATCTCGATCTCG 66.7 −137
Rt621_6 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase M −2.028 CGAAATCCGCTGCGAGATATAA 66.7 130
Rt623_92 Glycosyl transferase M −2.450 TGAAGTCTTGGGACTGACATCA 66.7 −106
Rt780_45 Polysaccharide biosynthesis protein M 7.890 TTGAAACGA-GCCTGGATTACG 63.6 291
Rt627_76 Polysaccharide biosynthesis protein GelA M 2.218 CGGATCGAAGCG-TG-AATTCG 63.6 22
Rt620_62 Exopolysaccharide biosynthesis protein PssA M −1.170 CGAAATGCTGTTGTTTAGTTCC 54.5 11
Rt772_12 Glycosyl transferase PssC M −1.451 CTGAAGCTCCGGGGCGAAGCTCG 63.6 −125
Rt780_150 Signal peptide protein H 3.925 ATGCATCAAATACTGCATGTCG 66.7 −239
Rt622_32 Ubiquinol oxidase subunit II C −6.942 CGAAAAATCCTTCTTGATTTCA 66.7 −231
Rt620_122 Iron transporter P −2.510 CGGAAGGCAGCGATGGTGTTCT 66.7 73
Rt772_17 PrsD component of type I secretion system MU 2.252 CTGCAGCTACGGGTCCATCAAG 59.1 −50
Rt646_16 Acyl-homoserine-lactone synthase (RaiI) T 6.049 AGCAATCTATGAATGGAATCGT 66.7 64
Rt628_39 Histidine kinase (PhoR) T 3.583 GGTAATCTAGCACCGTAATTTG 66.7 −200
Rt620_2 Crp/Fnr family transcriptional regulator T 7.049 TTTCAACTAAATGTAGACTTGA 66.7 −129
Rt628_38 Chemotaxis protein CheY T 4.010 GAGGATCTCGCCGGGGATTTCC 66.7 −299
Rt628_26 Chemotaxis protein CheY T −3.129 CGGAACCAATGTCAGCATTGAG 66.7 81
Rt782_109 Nitrogen regulatory protein P-II TE 3.152 CGGTATTCAGGGGCTGAC—-CG 63.6 80
Rt648_50 PhoB family transcriptional regulator TK 3.900 GGTCGTCAAGGTGTTGAACCAG 50.0 −167
Rt783_97 Transcriptional regulator K 4.442 CGGTGTCGGCCATCGGCTTTCG 66.7 −224
Rt794_73 TetR family transcriptional regulator K 3.385 CGTCATCTCGATGACCATTTCG 66.7 49
Rt764_77 TetR family transcriptional regulator K 2.774 TGAAATCTCCGCAGCCGTTCCA 66.7 40
Rt780_87 AraC family transcriptional regulator K 2.340 GCAAATCAATCGATCGATCTCG 66.7 117
Rt792_156 LysR family transcriptional regulator K 2.246 CAGGATCTGGAAGCCGATATCG 66.7 131
Rt641_47 LysR family transcriptional regulator K 2.237 CGGAAGGTGTTTTCGGATGCCG 66.7 −267
Rt636_12 GntR family transcriptional regulator K 2.044 CCGAAACTATCAGCGCGCTTCG 66.7 −45
Rt764_77 TetR family transcriptional regulator K 2.774 TGAAATCTCCGCAGCCGTTCCA 66.7 40
Rt634_21 Transcriptional regulator K −1.776 TCAAATCGCTACCCAGATCTTA 66.7 −126
Rt780_42 Membrane protein S 5.363 CGATATTTAATGATGGATACCA 66.7 −64
   RosR-box sequence   CGGAATCTAGGGGTGGATTTCG - -
  1. aIdentity of sequence motifs to the RosR-box was determined using 22-nt long sequences with the exception of their 4 nt in the middle of the sequence