Skip to main content

Advertisement

Table 5 Primer sequences for validation of novel noncoding RNAs

From: CANEapp: a user-friendly application for automated next generation transcriptomic data analysis

Human Hippocampus  
 AS1 Left Primer: ACTGGAGAAGCACGGGGA
Right Primer: AAGTTCCACGTGGCTGGG
 AS2 Left Primer: TCGAGCTGAGGACGTGGA
Right Primer: TTTCCTGCCTGGCTGGTG
 AS3 Left Primer: TCCCTGTGTGTCTGCACC
Right Primer: CCCACACTCAGTTCTTCCCA
 AS4 Left Primer: AGAGCGGTAGGGATACGCT
Right Primer: GCTGCTGATGGGTGGTCC
 AS5 Left Primer: CCATGCCTAGCCTCAGGG
Right Primer: CTATGTGAGCTTGGGCAAGT
 Linc1 Left Primer: CTGCCCTGTGGAGCATCC
Right Primer: CTCTGGCAAGGCGTTCCA
 Linc2 Left Primer: CCTGGCACCGCAGCAA
Right Primer: GCTGTCCTAATGCTTCATCCA
 Linc5 Left Primer: CAGGGCCCAGGATCCAGA
Right Primer: TGAATTACTGCCACGACCAAG
Mouse Cortex  
 AS1 Left Primer: GCCCAGGCTCTCCAGAGA
Right Primer: ATAGTCCCTCTCCCCGCC
 AS3 Left Primer: ACGAAAGGGTGCCTTCCC
Right Primer: GCTTACTCCCGTCACCCC
 AS5 Left Primer: TTCTTGGACAGCGACCCC
Right Primer: AGCGTCAGGAAATGGCCA
 Linc1 Left Primer: TCAGGAGAAGCAGCGTGC
Right Primer: TCCTTCTCCAGATCTCAGGGT
 Linc2 Left Primer: TGGTCATGAACTTGTTCCTGT
Right Primer: GCCTGGACTCCTATGCTCA
 Linc4 Left Primer: CCAGGAACGGCTGAGACG
Right Primer: CTCACAGGCCAGCTGGAG
 Linc5 Left Primer: GCTGCTCCGAGCTCAGTC
Right Primer: TTTGGAGCGGTCCTGCAG