Skip to main content

Table 3 Identification of new miRNA members of known miRNA families

From: Identification of miRNAs and their targets by high-throughput sequencing and degradome analysis in cytoplasmic male-sterile line NJCMS1A and its maintainer NJCMS1B of soybean

Index miRNA_name miRNA_sequence Length (nt) MFE (kcal/mol/nt) MFEI NJCMS1A_ count NJCMS1B_ count 3p/5pa)
1 N-gma-miR164l TGGAGAAGGGGAGCACGTGCA 21 −0.53 0.98 12 8 5p
2 N-gma-miR164m TGGAGAAGGGGAGCACGTGCA 21 −0.52 0.97 12 8 5p
3 N-gma-miR164n TGGAGAAGGGGAGCACGTGCA 21 −0.54 0.97 12 8 5p
4 N-gma-miR164o TGGAGAAGGGGAGCACGTGCA 21 −0.53 1.15 12 8 5p
5 N-gma-miR164p TGGAGAAGGGGAGCACGTGCA 21 −0.48 0.90 12 8 5p
6 N-gma-miR164q TGGAGAAGGGGAGCACGTGCA 21 −0.49 1.07 12 8 5p
7 N-gma-miR164r-5p TGGAGAAGCAGGGCACATGCT 21 −0.57 1.20 78 35 5p
8 N-gma-miR164r-3p CTTGTGTCCTACTTCTCCAGC 21 −0.57 1.20 4 0 5p
9 N-gma-miR156ac CTGACAGAAGATAGAGAGCAC 21 −0.40 0.86 85 69 5p
10 N-gma-miR395n CTGAAGTGTTTGGGGGAGCTT 21 −0.41 0.91 5 6 3p
11 N-gma-miR399i-5p GAGCAATTCTCCTTTGGCAGA 21 −0.48 1.15 2 0 5p
12 N-gma-miR399i-3p TGCCAAAGGAGAATTGTCCTG 21 −0.48 1.15 6 0 3p
13 N-gma-miR399j TGCCAAAGGAGATTTGCCCTG 21 −0.44 0.98 0 9 3p
14 N-gma-miR399k-5p GAGCAAATCTCCATTGGCAGT 21 −0.45 1.01 0 5 5p
15 N-gma-miR399k-3p TGCCAAAGGAGATTTGCCCTG 21 −0.45 1.01 0 9 3p
16 N-gma-miR399l TGCCAAAGGAGAGCTGCCCTG 21 −0.43 1.07 97 53 3p
17 N-gma-miR399m TGCCAAAGGAGAGCTGCCCTG 21 −0.45 1.17 97 53 3p
18 N-gma-miR530f TGCATTTGCACCTGCGCTTTG 21 −0.47 0.96 8 0 5p
19 N-gma-miR4380c TGGTTCATACGGATTGTTGAT 21 −0.47 1.12 5 0 3p
20 N-gma-miR4380d TGGTTCATACGGATTGTTGAT 21 −0.33 1.28 5 0 3p
21 N-gma-miR4348d TGTCAAACTTGCAAGATGATA 21 −0.45 1.46 0 10 5p
22 N-gma-miR5673b TGGAATCTCGCGGAAGACATC 21 −0.61 1.27 5 0 3p
23 N-gma-miR5786b CGTCGCAGGATAGAGGGCACTG 22 −0.39 0.94 0 8 5p
  1. N new. a) Arm of this mature miRNA