Skip to main content

Table 2 miRNAs not previously reported in cassava

From: High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs

Precursor ID Annotation Sequence Loci Length Abundance Stem Leaf Callus Male Female
(A) Conserved cassava miRNAs
cas-m0858 mes-miR156k UUGACAGAAGAGAGAGAGCAC 1 21 22383 57 93 8 13033 9192
cas-m1200 mes-miR159a AGCUGCUGAGCUAUGGAUCCC 1 21 29068 1375 4354 1603 9188 12548
cas-m0832 mes-miR160f UGCCUGGCUCCCUGAAUGCCA 2 21 883 36 696 40 62 49
cas-m0964 mes-miR166j UCGGACCAGGCUUCAUUCC 1 19 139123 10643 50196 4910 23213 50161
cas-m0467 mes-miR167b UGAAGCUGCCAGCAUGAUCU 1 20 2187 21 835 31 621 679
cas-m0739 mes-miR169ac UAGCCAAGGAUGACUUGCCU 6 20 465 275 147 1 14 28
cas-m1682 mes-miR169ad UCACAGGCUCUUAUUUUUCAUG 2 22 586 194 391 0 1 0
cas-m1733 mes-miR171a UUGAGCCGCGUCAAUAUCUCC 1 21 2656 472 375 98 1216 495
cas-m0456 mes-miR171e UUGAGCCGCGCCAAUAUCACU 2 21 2252 491 76 1593 83 9
cas-m2305 mes-miR171l CGAGCCGAACCAAUAUCACUC 1 21 1854 133 22 1631 40 28
cas-m2015 mes-miR319f AUUGGACUGAAGGGAGCUCC 1 20 935 18 2 1 285 629
cas-m0154 mes-miR390b AAGCUCAGGAGGGAUAGCGCC 3 21 8945 75 60 3892 2519 2399
cas-m0558 mes-miR393a UCCAAAGGGAUCGCAUUGAUC 2 21 5188 163 255 237 3608 925
cas-m2808 mes-miR397b UCAUUGAGUGCAGCGUUGAUG 1 21 4455 733 177 3122 210 213
cas-m2480 mes-miR398 UGUGUUCUCAGGUCGCCCCUG 1 21 76630 4157 47642 21171 2646 1014
cas-m0342 mes-miR399h GGGCACCUCUCGCUUGGCAGG 2 21 395 60 179 1 53 102
cas-m1234 mes-miR477j ACUCUCCCUAAAGGCUUCAAC 1 21 32998 16992 10477 18 1823 3688
cas-m2132 mes-miR477k ACUCUCCCUCAAGAGCUUCUC 1 21 1155 392 230 1 213 319
cas-m2133 mes-miR477k ACUCUCCCUCAAGGGCUUCCGG 1 22 766 177 89 0 216 284
cas-m2631 mes-miR2118 GUUCCCAUGCCACCCAUUUCUA 1 22 1443 4 0 747 311 381
cas-m1386 mes-miR482b UUCCCAAUGUCGCCCAUUCCGA 1 22 123159 34880 11732 45699 10031 20817
cas-m1250 mes-miR482c UUUUCCCAAGACCUCCCAUACC 1 22 78356 14942 19227 5369 20157 18661
cas-m1252 mes-miR482d UUCCCGACACCACCCAUUCCAU 1 22 63034 8837 31874 10068 5962 6293
cas-m1150 mes-miR482e UCUUACCUACACCGCCCAUGCC 1 22 141313 21276 53388 37559 16820 12270
cas-m1439 mes-miR530b UGCAUUUGCACCUGCACCUUA 2 21 828 174 98 5 489 62
cas-m1858 mes-miR535c UUGACGACGAGAGAGAGCACA 1 21 29985 6341 15644 721 4628 2651
cas-m0441 mes-miR535d UUGACGACGAGAGAGAGCACG 1 21 44468 9657 27521 2842 2686 1762
cas-m0742 mes-miR1446b UGAACUCUCCCCCUCAACGGCU 2 22 5022 143 249 4491 47 92
cas-m1168 mes-miR3627 UUGUCGCAGGAGCGGUGGCACC 1 22 83898 130 17457 6199 43406 16706
cas-m0627 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG 2 22 42015 8743 9998 14910 6921 1443
cas-m0849 mes-miR9386 UUUGCAGUUCGAAAGUGGAAGC 4 22 640035 315289 146661 100523 71814 5748
(B) Novel cassava miRNAs
cas-m0099 mes-miR11891 CAUAAAUUGAACUAUAGACC 2 20 386 0 1 0 378 7
cas-m2996 mes-miR11892 UUGUCAUCUCAACCUUGUGUC 1 21 382 111 176 33 42 20