Skip to main content

Table 3 PHAS loci and their predicted miRNA triggers in cassava

From: High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs

# Genomic Location miRNA annotation miRNA trigger sequence PHAS locus annotation
1 chr11297:309359..310709 mes-miR2118 variant UCUUCCCUACUCCACCCAUUCC Disease resistance protein
2 chr3241:338192..338338 mes-miR2118 variant UCUUCCCUACUCCACCCAUUCC Disease resistance protein
3 chr7318:236818..238124 mes-miR2118 variant UCUUCCCUACUCCACCCAUUCC Disease resistance protein
4 chr11297:309359..310709 mes-miR482 variant UCUUACCUACACCGCCCAUGCC Disease resistance protein
   mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
   mes-miR482 variant UUCCCGACACCACCCAUUCCAU Disease resistance protein
5 chr3241:338192..338338 mes-miR482 variant UCUUACCUACACCGCCCAUGCC Disease resistance protein
   mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
6 chr12263:763..1197 mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
7 chr4251:480755..482506 mes-miR482 variant UUCCCGACACCACCCAUUCCAU Disease resistance protein
   mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
8 chr6149:194641..195722 mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
9 chr6779:4987..6527 mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
   mes-miR482 variant UCUUACCUACACCGCCCAUGCC Disease resistance protein
10 chr6914:328331..331372 mes-miR482 variant UCUUACCUACACCGCCCAUGCC Disease resistance protein
   mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
11 chr7318:236818..238124 mes-miR482 variant UUCCCGACACCACCCAUUCCAU Disease resistance protein
12 chr8022:3220..3904 mes-miR482 variant UCUUACCCACACCACCCAUUCC Disease resistance protein
13 chr6914:1175645..1177025 mes-miR482 variant UCUUACCUACACCGCCCAUGCC  
   mes-miR482 variant UCUUCCCUACUCCACCCAUUCC  
   mes-miR482 variant UCUUACCCACACCACCCAUUCC  
14 chr4065:15455..16439 mes-miR171 variant UUGAGCCGUGCCAAUAUCACG Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGCGCCAAUAUCACU Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGCGUCAAUAUCUCC Scarecrow transcription factor family protein
   mes-miR171 variant CGAGCCGAACCAAUAUCACUC Scarecrow transcription factor family protein
15 chr7035:1010275..1010518 mes-miR171 variant UUGAGCCGCGCCAAUAUCACU Scarecrow transcription factor family protein
   mes-miR171 variant UGAUUGAGCCGUGCCAAUAUC Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGUGCCAAUAUCACG Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGCGUCAAUAUCUCC Scarecrow transcription factor family protein
16 chr8265:4464569..4465812 mes-miR171b UUGAGCCGUGCCAAUAUCACG Scarecrow transcription factor family protein
   mes-miR171g UGAUUGAGCCGUGCCAAUAUC Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGCGCCAAUAUCACU Scarecrow transcription factor family protein
   mes-miR171 variant UUGAGCCGCGUCAAUAUCUCC Scarecrow transcription factor family protein
17 chr11998:1784141..1785228 mes-miR393 variant (21 nt) UCCAAAGGGAUCGCAUUGAUC TRANSPORT INHIBITOR RESPONSE 1 protein
   mes-miR393c UCCAAAGGGAUCGCAUUGAUCU TRANSPORT INHIBITOR RESPONSE 1 protein
18 chr4457:778245..778858 mes-miR393 variant (21 nt) UCCAAAGGGAUCGCAUUGAUC TRANSPORT INHIBITOR RESPONSE 1 protein
   mes-miR393c UCCAAAGGGAUCGCAUUGAUCU TRANSPORT INHIBITOR RESPONSE 1 protein
19 chr363:44227..44849 mes-miR393 variant (21 nt) UCCAAAGGGAUCGCAUUGAUC TRANSPORT INHIBITOR RESPONSE 1 protein
   mes-miR393c UCCAAAGGGAUCGCAUUGAUCU TRANSPORT INHIBITOR RESPONSE 1 protein
20 chr5432:169723..170470 mes-miR393 variant (21 nt) UCCAAAGGGAUCGCAUUGAUC Auxin signaling F-box 2/Transport inhibitor response family protein
   mes-miR393c UCCAAAGGGAUCGCAUUGAUCU Auxin signaling F-box 2/Transport inhibitor response family protein
21 chr11998:653257..654250 mes-miR393 variant (21 nt) UUGUCGCAGGAGCGGUGGCACC Calcium-transporting ATPase
22 chr10563:295491..295785 mes-miR396a UUCCACAGCUUUCUUGAACUG Cation-transporting ATPase (ACA13)
23 chr3428:159666..159843 mes-miR3627 UUGUCGCAGGAGCGGUGGCACC Autoinhibited Ca(2+)-ATPase 10
24 chr12525:207356..207864 mes-miR828/mes-miR858 UUCGUUGUCUGUUCGACCUUG MYB transcriptioin factor
   mes-miR828/mes-miR858 UUCGUUGUCUGUUCGACCUUG  
   mes-miR167a UGAAGCUGCCAGCAUGAUCUG Auxin response factor
25 chr4251:297744..298010 mes-miR167 variant (21 nt) UGAAGCUGCCAGCAUGAUCU Auxin response factor
   mes-miR167a UGAAGCUGCCAGCAUGAUCUG Auxin response factor
26 chr4616:49725..50256 mes-miR160 variant UGCCUGGCUCCCUGAAUGCCA Auxin response factor
   mes-miR160a UGCCUGGCUCCCUGUAUGCCA Auxin response factor
27 chr3219:169296..170233 mes-miR172e GGAAUCUUGAUGAUGCUGCAG Tetratricopeptide repeat-like superfamily protein
28 chr3219:75237..75832 mes-miR172e GGAAUCUUGAUGAUGCUGCAG  
   mes-miR167a UGAAGCUGCCAGCAUGAUCUG  
   mes-miR2118 variant UUCCCAAUGUCGCCCAUUCCGA  
   mes-miR167c UGAAGCUGCCAGCAUGAUCU  
29 chr5214:913834..914121 mes-miR390 AAGCUCAGGAGGGAUAGCGCC TAS3
30 chr708:185545..185783 mes-miR390 AAGCUCAGGAGGGAUAGCGCC TAS3
31 chr5739:33..183 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG NAC transcription factor
32 chr5739:392..504 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG  
33 chr3614:677234..678063 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG NAC transcription factor
34 chr7571:169851..170001 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG NAC transcription factor
35 chr7571:170211..170332 mes-miR6445 UUCAUUCCUCUUCCUAAAAUGG