Skip to main content

Advertisement

Table 3 Primers used to amplify different MHC sequences in Old World camelids

From: The major histocompatibility complex in Old World camelids and low polymorphism of its class II genes

Locus Name Sequence (5' → 3') Purpose PCR product length
DRA DRA-EXON2-F TGAGAATTTTGGGTTTGCTTATGGCA Bact, drom 514 bp
DRA-EXON2-R CCTCTGAGCAACACGAACGTCCTTCA
DRA-EXON2-WC-F TGGGTGTTTCAGCTCTTGTG Ferus 650 bp
DRA-EXON2-WC-R AGATACCATGGGTGGCAAAG
DRA-EXON2-3-F CCCTGGAATTCGGGTTTAAG Preventing allele dropout 923 bp
DRA-EXON2-3-R GGCTGAAAAAGCAGTTGAGC
DRA_F1 TGATCATCCAGGCTGAGTTC Ancient samples 139 bp
DRA_R1 GCAAACCGTCCAAATTCTTC
DRA_F2 CGTGGATCTGGAAAAGAAGG Ancient samples 154 bp
DRA_R2 ATTGGTGTTCGGGGTGTG
DRB DRB-EXON2-2-F AGCAGTGGGGGTCCTAGTG Bact, drom 457 bp
DRB-EXON2-2-R ACCCACCCGGACTCAGTATC
DRB-EXON2-WC-F TTCAGGAGGAGGTGGTGATG Ferus 764 bp
DRB-EXON2-WC-R CTCAGACCCCAGACCCATT
DRB-EXON2-3-F GCCAGCCCTAGGCAAGTAAG Preventing allele dropout 852 bp
DRB-EXON2-3-R GTTCTCTCAGACCCCAGACC
DQA DQA1-EXON2-F CATGAAAGTCAATTTATCCTGTCAC Bact 351 bp
DQA-EXON2-2-R AGTGAGGCCTGGTATGAAGG
DQA-EXON2-WC-F ACGTGCTGGGAATTTTGTCT Drom 414 bp
DQA-EXON2-2-R AGTGAGGCCTGGTATGAAGG
DQA-EXON2-WC-F ACGTGCTGGGAATTTTGTCT Ferus 646 bp
DQA-EXON2-WC-R GCTATGGGAGCTTTCCTTGA
DQA-EXON2-4-F ATGGTGCAGAGAGCAGAAGG Preventing allele dropout 1096 bp
DQA-EXON2-4-R TGGGAAACACAGTCACCTCA
DQA_F1 YGGCRTAAATGTCTACCAGTC Ancient samples 133 bp
DQA_R1 TSRAAACTTGSTAAACAGAGG
DQA_F2 CGTGGACTTGGAGAAGAAGG Ancient samples 145 bp
DQA_R2 AGCAGTAGAGTTGGAGCGTTT
DQB GH 28 CTCGGATCCGCATGTGCTACTTCACCAACG Bact, drom, ferus 181 bp
GH 29 GAGCTGCAGGTAGTTGTGTCTGCACAC
FANCA KN276514-F TCAAGTCAGAAACAAGAACACAGA FISH probe MHCII 3574 bp
KN276514-R CATCATTGCCAGATCCTTCA
TRIM39 KN277189-F CCACCCACCATGTGTATGAA FISH probe MHCI 3459 bp
KN277189-R GCTGAGAGTGCAGGGATAGG
  1. Bact - Primer pair used to amplify samples of Camelus bactrianus. Drom - Primer pair used to amplify samples of Camelus dromedarius. Ferus - Primer pair used to amplify samples of Camelus ferus