Skip to main content

Table 2 Novel or candidate miRNAs found in pear buda

From: Small RNA and PARE sequencing in flower bud reveal the involvement of sRNAs in endodormancy release of Japanese pear (Pyrus pyrifolia 'Kosui')

Name miRNA _sequence Length Contig miRNA* sequence Pipeline usedb
miRn1 TGCGTTTGCACCTGCACCTCT 21 scaffold303.0 AAGGTGCAGGTGTAACTGCAG miRCAT
miRn2 CGAAGACCTTGGGGAGAGTGG 21 scaffold1160.0 ACTCTCCCTCAAGGGCTTCGA miRCAT
miRn3 AAGCGGAGTAATGGTTACTGA 21 scaffold276.0 AGAGCTGCATTATTCTCTTGT ShortStack
miRn4 TCACCTTGTAAAAAATTGGCC 21 scaffold266.0 CAATTTTTTATAAGGTGAAT ShortStack
miRn5 TCGGGACAGCGTACTTGAGTT 21 scaffold230.0 CTCACGCGCGCTGTCCCGAGA ShortStack
miRn6 TTGAGGATGCATAGTTTTCAG 21 scaffold266.0 GAAAATAATGCATCTTCAACG ShortStack, miRCAT
miRn7 GTGTAACCGTCGTAATGTCCC 21 scaffold198.0 GACATTACAACGGCCACACGG ShortStack
miRn8 CTGCCAAAGGAGATCTGCTCAG 22 scaffold1.0 GAGCAGTCTCCTCTTGGCAAAC ShortStack,miRCAT
miRn9 TCCCTAAAACCACCAAGGCCAA 22 scaffold2.0 GGCTTTAGTGGGTTAGGAAGA ShortStack
miRn10 GCGTACGAGGAGCCAAGCATA 21 scaffold32.0 TGCCTGGCTCCCTGTATGCCA miRCAT
miRn11 AATAATTGTAGTCGTTGGATCA 22 scaffold371.0 TTTGATCTAACGGCTACAAACA miRCAT
miRn12 TGGTGTTTGGATGGACGTGTT 21 scaffold862.0 TAAGTTCATCCAAACACCATA ShortStack
miRn13 AGGTGCAGGTGTAACTGCAGA 21 scaffold303.0 TGCGTTTGCACCTGCACCTCT ShortStack
miRn14 ACCTAGCTCTGATACCATAAA 21 scaffold3.0 TGTGGTATCAGGACTATGTTA ShortStack
miRn15 GGTTTGAGTGGATTGGGAAGA 21 scaffold2.0 TTCTTAAAACCACTCAAGCCAA ShortStack, miRCAT
miRn16 TTCTTGACCACCGACGCCGACA 22 scaffold131.0 TTGGCGTCGTGGTCAAGAAGG ShortStack
miRn17 AAAACCGCGGATTGGGGCGTG 21 scaffold17.0 NO miRCAT
miRn18 AAGAGATATGGACCGTTGGATA 22 scaffold1.0 NO miRCAT
miRn19 AATGACGTGTGGCATATCATC 21 scaffold28.0 NO miRCAT
miRn20 ACACGATGTATGATGAACGG 20 scaffold1044.0 NO miRCAT
miRn21 ACCTGATTGGTTGCTGTTGGAT 22 scaffold89.0 NO miRCAT
miRn22 ACTTTGGGATGTGGCAATGTGA 22 scaffold285.0 NO miRCAT
miRn23 AGGAGACGAAGAAACTGGTGC 21 scaffold463.0 NO miRCAT
miRn24 AGGAGAGGGAGGTGGGTCGGG 21 scaffold6.0 NO miRCAT
miRn25 AGGATGAGCTGAAGATGATAA 21 scaffold1.0 NO miRCAT
miRn26 CAAAGTTTTTGGAATGTTGCA 21 scaffold54.2 NO miRCAT
miRn27 CCGAACTTGGTGGATTAGGAG 21 scaffold1.0 NO miRCAT
miRn28 CCGGATTTCGTGGTCAGGAGG 21 scaffold124.0 NO miRCAT
miRn29 CCTGACTGTTGATGCATGTAGG 22 scaffold373.0 NO miRCAT
miRn30 CCTTGTTTAGGGTATGTAGGCA 22 scaffold1113.0 NO miRCAT
miRn31 CGAACTTGGTGGATTAGGAGG 21 scaffold30.0 NO miRCAT
miRn32 CGAGGGTGTGGTGTAGGGTGG 21 scaffold181.0 NO miRCAT
miRn33 CGATGAACGGACGTGATTGGA 21 scaffold10.0 NO miRCAT
miRn34 CGATGTACGATGAACGGACACA 22 scaffold1279.0 NO miRCAT
miRn35 CGCCTTGGCGAAACTCTAGGAA 22 scaffold310.0 NO miRCAT
miRn36 CGGAATACGGATGGTACACCA 21 scaffold63.0 NO miRCAT
miRn37 CGGATTTCGTGGTCAGGAGGA 21 scaffold228.0 NO miRCAT
miRn38 CGGTCAGTAGGATCCCAAGGCA 22 scaffold242.0 NO miRCAT
miRn39 CGTACGATATACAATGAACGGT 22 scaffold171.0 NO miRCAT
miRn40 CGTACGATCTACGATGAACGG 21 scaffold182.0 NO miRCAT
miRn41 CTAATGACATTATAGAGGACA 21 scaffold103.0 NO miRCAT
miRn42 CTGCACAATGTACGATGAACGG 22 scaffold13.0 NO miRCAT
miRn43 CTGTACGATATATGATGAACGG 22 scaffold1196.0 NO miRCAT
miRn44 GAATACGGATGGTACACCAT 20 scaffold330.0 NO miRCAT
miRn45 GCATTTGGATTTGTCTGACTTG 22 scaffold1206.0 NO miRCAT
miRn46 GGGACTTTCAAATTCCGAGGG 21 scaffold353.0 NO miRCAT
miRn47 GTCAAACTGTGATTTGTAGGCA 22 scaffold94.0 NO miRCAT
miRn48 GTGACTGATGACATGTTGTAG 21 scaffold322.0 NO miRCAT
miRn49 TAGGCGTAGATAGACCGTGGG 21 scaffold144.0 NO miRCAT
miRn50 TCAAATTTCAAAGGTCCGGATC 22 scaffold221.0 NO miRCAT
miRn51 TCACACTATGGAGCGATGGTC 21 scaffold1.0 NO miRCAT
miRn52 TCCTCGAACTGTAGCAATGGC 21 scaffold44.1 NO miRCAT
miRn53 TCTAACGGTCAAGAGGATGTC 21 scaffold751.0 NO miRCAT
miRn54 TCTGGATGCATGAATTTGGTA 21 scaffold83.0 NO miRCAT
miRn55 TGAACGGACATGATTTGAGGA 21 scaffold3.0 NO miRCAT
miRn56 TGGATTTGGTAGAAGGGATCC 21 scaffold12.0 NO miRCAT
miRn57 TGTGATGTGTGGTTACGGTT 20 scaffold235.0 NO miRCAT
miRn58 TTCAGGGCTCTGAGTGGGATGG 22 scaffold48.0 NO miRCAT
miRn59 TTGGATTAAAATTGAACGGCC 21 scaffold114.0 NO miRCAT
  1. aAdditional file 4: Figure S1 showed the stem-loop structure of the predicted precursors of each pear-specific miRNAs
  2. bPipeline(s) that successfully identified the miRNA loci