Skip to main content

Table 1 Primers used in quantitative real-time PCR

From: A subtracted cDNA library identifies genes up-regulated during PHOT1-mediated early step of de-etiolation in tomato (Solanum lycopersicum L.)

Identification Description of the gene Primers Primer efficiency
A-E4 Mitogen-activated protein kinase F: 5′- GAAGATGAGAAACCACAAGCG 90 %
R: 5′- CATTCTGAGGAACTTGGAGAGG
C-G1 Importin subunit alpha1a F: 5′- GAACTCATTTTGTGCCCCATC 92 %
R: 5′- GCTGAGGGATTGGAAAAGATTG
E188 Intracellular Ras-group-related LRR protein 9 F: 5′- GAGAGGCAGGATTGGAGATTG 94 %
R: 5′- TCCGCATCCTTCAACATCTTC
E-E3 Polyadenylate-binding protein RBP47 F: 5′- TCCTAATGAGCCTAACAAACCTG 92 %
R: 5′- TCCGTCTTATTGCCTTCCAC
VHA-A1 V-ATPase catalytic subunit A1 F: 5’- CGAGAAGGAAAGCGAGTATGG 107 %
R: 5’- TCATTCACCATCAGACCAGC
B-D5 Vacuolar H + -ATPase V0 sector F: 5′- GCAGTCATTATCAGTACCGGG 89 %
R: 5′-TCTAACACCAGCATCACCAAC
B-E2 Pectin acetylesterase F: 5’-CACACCCACAAAGAGAAACAG 103 %
R: 5’-TTCCAAGAATGCCCCTTCAG
12. XTH F: 5’-AGAGGTGGGCTTGAGAAAAC 93 %
R: 5’-GAACCCAACGAAGTCTCCTATAC
B-D9 26S proteasome F: 5’-TCTTGTCCTCTTTCTGTTCCTTATC 95 %
R: 5’-AATCCTTGCCTCACTTCCAG
C-A3 Histone H2B F: 5′- TTGGTAACAGCCTTAGTTCCTC 89 %
R: 5′- AAAGCCTACCATCACTTCTCG
PP2ACS PROTEIN PHOSPHATASE 2A catalytic subunit F: 5’- CGATGTGTGATCTCCTATGGTC 98 %
R: 5’- AAGCTGATGGGCTCTAGAAATC