Skip to main content

Table 4 List of strains, plasmids and primers used in the present study

From: The genome and genetics of a high oxidative stress tolerant Serratia sp. LCN16 isolated from the plant parasitic nematode Bursaphelenchus xylophilus

Strain, plasmid and primers Genotype or phenotype
Serratia sp.
 LCN16 WT WT resistant to ampicillin and erythromycin.
 LCN16 oxyR::int(614) Knockout mutant of oxyR with group II intron inserted in the position 614; Resistant to gentamicin and kanamycin.
 LCN16 katA::int(808) Knockout mutant of katA with group II intron inserted in the position 808; Resistant to gentamicin and kanamycin.
Escherichia coli
 DH5α Competent cells (Sigma-Albrich)
Plasmids
 pAR1219 TargeTron vector with chloramphenicol resistant
 pAR1219-ΩGm Constructed vector with gentamicin resistant gene aacC
 pACD4K-C TargeTron vector; kanamicin RAM marker (for chromosomal insertion) and chloramphenicol resistance (plasmid propagation)
 pACD4K-C_oxyR TargeTron vector with intron RNA retarget for oxyR gene
 pACD4K-C_kat TargeTron vector with intron RNA retarget for kat gene
 pBK-miniTn7-ΩGm Tn7 plasmid constructed with gentamicin resistant gene aacC
PCR Primers (5′-3′)
 aacC1_IfFor CATACTCTTCCTTTTTCAATATTATTG
 aacC1_IfRev TAACTGTCAGACCAAGTTTACTC
 oxyR_614|615 s-IBS AAAAAAGCTTATAATTATCCTTAGGAAGCTGGTCAGTGCGCCCAGATAGGGTG
 oxyR_614|615 s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCTGGTCACTTAACTTACCTTTCTTTGT
 oxyR_614|615 s-EBS2 TGAACGCAAGTTTCTAATTTCGATTCTTCCTCGATAGAGGAAAGTGTCT
 oxyR_KO_chkFor CGTGGTCTGGAGGGAAACAA
 oxyR_KO_chkRev CATAACGACTGCGCAATGGG
 katA_808|809a -IBS AAAAAAGCTTATAATTATCCTTATAATCCGGATTTGTGCGCCCAGATAGGGTG
 katA_808|809a EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCGGATTTGCTAACTTACCTTTCTTTGT
 katA_808|809a -EBS2 TGAACGCAAGTTTCTAATTTCGGTTGATTATCGATAGAGGAAAGTGTCT
 katA_KO_chkFor GGTGAAGTTCCATTTCCGCTGC
 katA_KO_chkRev GGGTTCACCGCTACCTGTTCAAC
RT-qPCR primers (5′-3′)
 gyrA_For TTATCTCCCTGATTGTGCCA
 gyrA_Rev CATTACGCTCGCTCACCTTA
 oxyR_For TTTAGAGTACCTGGTCGCCTTG
 oxyF_Rev ATCACACCCAGTTCGTCTTCC
 katA_For CCAGATTATGCCTGAACACG
 katA_Rev TGCAGTTCGAAGAAACCAAC
 katG_For AGCGGTAAGCCAAATACACC
 katG_Rev AATCGAAGTCAGGGTCCATC