Skip to main content

Table 3 Primers of qRT-PCR assay used for eight RNA-seq libraries in this study

From: Transcriptome analysis revealed the drought-responsive genes in Tibetan hulless barley

Gene_id Amplicon size (bp)a Forward primer (5′- > 3′) Reverse primer (5′- > 3′)
HVU014442.1 142 ATTTCTTCGACTGGGGCCTG ATGACCTTGCCGTCGATCTC
HVU014441.1 190 CAGGAGCCTGAGTAGATGCG AATGAGAGGCCGACCACAAG
HVU029679.1 194 AAGAAACTGATCCGAGGCGG ATTCGTCCGGCCCGTATTTT
HVU021835.1 180 GCGGCTATATCCCACCTTCC AAGAGCTGAGGTGAAGCGAC
HVU015180.1 208 TGGAGAAACGGATCGAAGCC TGCAGCCCAGCTAGAAAAGG
HVU021802.1 206 CCTTCACCTCCAGGAACGTC CACTCCGATTCCACTTGGCT
HVU025938.1 180 TGTCACCGCTGAACCAATCA TTCACTGGGATTCACGGACG
HVU026759.1 86 GAAGTCGCGCGAATCTGTTC GAGCAGAGCAGCCAGATCAA
HVU015112.1 215 AAGATCCCAACAAGGCGAGG CCTGGCTTGCTCCTCTTTGA
HVU001215.1 229 AAGCATGCCGTCTTACACCA GGCCATCGGAGAGTGCATTA
HVU012352.1 163 TGGCGTGTCAGCTGAGATTT GGCCGTGAAGGACCAAAAAC
HVU033128.1 214 CCATCAGACTGTGGCGTCTT GAACCCTCTGCGCATAGACA
HVU023469.1 244 AGCACTACTACGGCACCAAC CTGAAACCGGCGTACTCCTT
HVU007307.1 216 AGATGGGGTGCGAACTTGAG CAGGGACAGGACCATCCAAC
HVU011039.1 115 GGTGATCATGCGTGTGTTCG CTTCTTGGCCGAGTCCTTGT
HVU033209.1 234 AGCCCAAACCTACCAAGCTC ATCATAGCGCAGGAGCCATC
HVU000918.1 87 GTAGCTATCCACGGTCACGG TGGAACTGTAAGCGTCCACC
HVU007765.1 208 CGCATGCTGATGGAAAAGGG ATTGCACCGCACTCAACAAC
HVU006724.1 135 TTTGTGTGGGGAGGTCGATG CATGCACTCTTCGGTGACCT
HVU016310.1 245 TGAGGATGAAGCGAGTGCAG TGGGGACTAGCACGCAAAAT
  1. aThe amplicon lengths for all the genes are within 70–250 bp range to satisfy the requirement for the primer pairs used for real time RT-PCR analysis using SYBR green according to manufacturer’s guide