Skip to main content

Table 3 Primers used for qRT-PCR validation

From: Transcriptome analysis reveals self-incompatibility in the tea plant (Camellia sinensis) might be under gametophytic control

Unigenes KEEG Annotation Gene Forward 5'–3' Reverse 5'–3'
CL12551Contig1 Apoptosis Serine/threonine-protein kinase TATTCCCTTTTCCGATCTTCGCTAT CAAAGATGAGTTGCTTTTCGTGTTG
CL23964Contig1 Calcium signaling pathway calcineurin B-like protein AAATTTGCATATCTGCCTGTGTCAA ATGTAAAACATCCAAAACCCCAGTC
CL32645Contig1 Flavonoid biosynthesis ANR AGTATGGCTTTTGTGCTTTGATTGA TAGAGGTGTCAAGGTTTCAGTTTCA
CL28991Contig1 Flavonoid biosynthesis CYP75A(F3'5'H) TTGTAAGTATGGGAGTTTGGGTAGG CGACACATCATCAAGCGTAATAGAG
CL26013Contig1 Flavonoid biosynthesis LDOX AGTTGGCTAATAATGCTAGTGGTCA TTTTCTAGTCGGCCTTCTTCTAGTC
CL20835Contig1 negative regulation of programmed cell death Probable WRKY 40 ATTGTACTTGTCGCAAATGTCTGTT CAATGTTAACCCACTTCCACTACAC
CL1Contig2502 Plant-pathogen interaction caffeoyl-CoA O-methyltransferase TCACAAGAACCAGACACAAACATTC TTAATGGGCACAAGGGTTATGTTTC
CL41260Contig1 Plant-pathogen interaction CPK GATTCCTAAACATTTCCAAGCCACA CTTTTAATGGTTGGACGGTGAGAAA
CL25650Contig1 Plant-pathogen interaction PR1 ACCGTTATTTGTACACTGAACCCTA TATGCTAATTCGAGGATGGGTGATT
CL21816Contig1 Plant-pathogen interaction RPS2 CCAATGGGACCTCTGAACTATTTTG TGCTTAAATTGCCTTTCAACGAAGA
CL2609Contig1 Plant-pathogen interaction CALM TGAAATCTATCATTCCATCCCCGTT GAAGGGAGCTTTTGATGTGTTTGAT
CL1Contig5289 ubiquitin mediated proteolysis Skp1 TGGGTTCCAATGGTATTGTTTGAAG CGAGTGGATTATCGTTCAGTTGATG
CL1Contig1054 ubiquitin mediated proteolysis Cullin-1 ATATGTGTGGTAACCCTATTGGTCC AATTCCCCGTAAACCAGTTCATAGA
CL25362Contig1 Response to auxin Protein TIFY 9 ATTGACGATTTTCTACAACGGAACC TCTCCAGAAGTTGATGTTGATCTGT
CL31783Contig1 Response to salicylic acid 12-oxophytodienoate reductase 11 TCATAACAAGGGTGGGATCTTCTTT CACTGTATCTTTCATGAACTGGTCG
CL25983Contig1 - Ribonuclease, T2 family CTGCGATAGCCGCAACTCTT GGAAGTAGCTGTGCTGGTCAA
GE651107 Reference gene GAPDH GGAAGCATCATGAACTCAAAGTGAA ATCCTTCTCATTGACACCCATAACA