Oligonucleotide | Sequence | Comments |
---|---|---|
PhiXa sens | GGC GCT CGT CTT TGG TAT GTA | Amplification and detection of 214Â bp fragment |
PhiXb sens | TGA ATT GTT CGC GTT TAC CTT | Amplification of 397Â bp fragment |
PhiXc sens | GTA CGC TGG ACT TTG TAG GAT | Amplification of 568Â bp fragment |
PhiX rev | GGC GTC CAT CTC GAA G | Amplification and detection of all 3 DNA fragments |
Adaptor sens | CTT TCC CTA CAC GAC GCT CTT | Detection of adaptor ligated fragments |
Adaptor rev | ATT CCT GCT GAA CCG CTC TTC | Detection of adaptor ligated fragments |
P5 primer | AAT GAT ACG GCG ACC ACC GA | Detection of final library fragments |
P7 primer | CAA GCA GAA GAC GGC ATA CGA | Detection of final library fragments |
Taqman probe | [6FAM]GCGATAACCGGAGTAGTTGAAATG[TAM] | Taqman probe targeting the common sequence between the 3 DNA fragments |