Skip to main content

Advertisement

Table 1 List of primers used in 5′ RACE, RT and genomic PCR

From: Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human

Locus Primer Genomic Orient.a Sequence 5′–3′ Primer length Location and sequence positions Description
TRG TC3L REV TGAGGAGGAGAAGGAGGT 18-mer TRGC EX3b 43364–43381 5′RACE, RT-PCR
  TC1L1 REV GACGATACATACGAGTTCA 19-mer TRGC EX1b 37807–37825 dC-TAILED cDNA
  TC1L3 REV AAGGCAAAGATGTGTTCCAG 20-mer TRGC EX1b 37635–37654 nested, RT-PCR
  TC1L2 REV TGTTGCCATTCTTTTCTTTCC 21-mer TRGC EX1b 37692–37712 nested, V1-V2 RT-PCR
  TV1LU FWD GCTCGCTCTGACAGTCCTT 19-mer TRGV1 L-Part1b 9989–10007 V1 RT-PCR, V1J2 genomic PCR
  TV7LU FWD GATCCTCTTCTCCTCCCTCTG 21-mer TRGV2 L-Part1b 21785–21805 V2 RT-PCR, V2J3 genomic PCR
  J2GL REV TGACGCTCTTGCCATGTGTT 20-mer TRGJ2b 31033–31052 V1J2 genomic PCR
  J5BR REV CGGCGATGGGACAAAACTTG 20-mer TRGJ3b 34698–34717 V2J3 genomic PCR
TRA TA1C1L REV GAAGGTCTGGTTGAAGGTG 19-mer TRAC EX1c 86762–86780 5′RACE, RT-PCR
  TA1C2L REV TGTCTCCGCATCCCAAATC 19-mer TRAC EX1c 86745–86763 dC-TAILED cDNA
  TA1C3L REV TGCTGGATTTGGGGCTTCT 19-mer TRAC EX1c 86574–86592 nested PCR
TRD TD1C1L REV AGAACTCCTTCACCAGAC 18-mer TRDC EX1d 85917–85934 5′RACE, RT-PCR
  TD1C2L REV CTTATAGTTACATCTTTGGG 20-mer TRDC EX1d 85938–85957 dC-tailed cDNA
  TD2CL REV CTGGAGTTTGAGTTTGATT 19-mer TRDC EX2d 86773–86791 nested PCR
  VD4U FDW GTGGAAGGTTTTGTGGGTCAGG 22-mer TRDV4 EXd 91850–91871 V4 genomic PCR
  VD4L REV TAACCAAGTGACCCAGATTT 20-mer TRDV4 EXd 92062–92081 V4 genomic PCR
  1. aFWD: forward orientation, REV: reverse orientation (IMGT, Genomic orientation, http://www.imgt.org/IMGTindex/Orientation.php)
  2. bAcc. Number: JH473572.1
  3. cAcc. Number: EnsS_112178
  4. dAcc. Number: JH481615.1