Skip to main content

Table 1 Primer sequences for used qRT-PCR validation. List of primers and their sequences of selected candidate genes used for qRT-PCR validation of microarray data

From: Deciphering transcriptome profiles of peripheral blood mononuclear cells in response to PRRSV vaccination in pigs

GenBank Gene name Primer sequence (5′-3′)
Accession number
NM_213770.1 IRF3: Interferon regulatory factor 3 F: CCAGTGGTGCCTACACTCCT
R: AGAGGTGTCTGGCTCAGGAA
NM_001044580 STAT3 : Signal transducer and activator of transcription 3 (acute-phase response factor) F: TGCTGGAGGAGAGAATCGT
R: GGGAATTTGACCAGCAATC
NM_214087 CD80: Cluster of differentialtion-80 F: TCAGACACCCAGGTACACCA
R: GACACATGGCTTCTGCTTGA
NM_001105286.1 TRAF6: Tumor necrosis factor receptor-associated factor F: GGGAACGATACGCCTTACAA
R: CTCTGTCTTAGGGCGTCCAG
NM_213779 CCL4 : Chemokine (C-C motif) ligand 4 F: CTCTCCTCCAGCAAGACCAT
R: CAGAGGCTGCTGGTCTCATA
HQ013301 GAPDH : Glyceraldehyde-3-phosphate dehydrogenasea F: GCTGGTGCTGAGTATGTCGT
R: AAGCAGTTGGTGGTACAGG
XM_003124280.3 ACTB: Actin, Betaa F: AAGGACCTCTACGCCAACAC
R: CTGGCTGATCCACATCTGCT
  1. a are the house keeping genes used for normalization