Skip to main content

Table 1 Gene name, accession number, functional pathway, primer sequences, and product length of qPCR validated genes

From: Transcriptome profiling of the rumen epithelium of beef cattle differing in residual feed intake

Gene name (symbol) GenBank accession number Functional pathway Forward and reverse primer sequence (5'-3') Product length (bp) Reference
Triosephosphate Isomerase 1 (TPI1) NM_001013589 Glycolysis, Gluconeogenesis, Acetylation Fwd: GGGAGGAAGAACAATCTGGGG 107 This study
Rev: GCGAAGTCAATGTAGGCGGT
Trans-2,3-Enoyl-CoA Reductase (TECR) NM_001034748 Biosynthesis of unsaturated fatty acids, Acetylation Fwd: CCAAGGGCAAGTCCCTGAAG 82 This study
Rev: AGGTCCCGGAAGTAGAGTGT
Cytochrome C Oxidase Subunit VIIIA (COX8A) NM_174024 Oxidative Phosphorylation Fwd: TTTGACTTCGCGACCTTGG 60 This study
Rev: TTACGGCACGGAGTAGACTG
Solute Carrier Family 25 Member 39 (SLC25A39) NM_001075415 Mitochondrial substrate/solute carrier Fwd: AGCTAATGCCTCCCTCCAGA 54 This study
Rev: GGCACTTCCATTTGGCGTAG
Pyruvate Kinase M2 (PKM2) NM_001205727 Glycolysis, Gluconeogenesis Fwd: TGTCACCCATTACCAGCGAC 130 This study
Rev: TATCTGGCCACCTGATGTGC
SUZ12 polycomb repressive complex 2 subunit (SUZ12) NM_001205587 Endogenous control Fwd: CATCCAAAAGGTGCTAGGATAGATG 160 [62]
Rev: TGGGCCTGCACACAAGAATG