Skip to main content

Advertisement

Table 5 Primer sequences used for real-time PCR with amplicon size and annealing temperature. All primer sets had R2 > 0.98 and efficiency percentage between 90 % and 110 %

From: Determining the mode of action of anti-mycobacterial C17 diyne natural products using expression profiling: evidence for fatty acid biosynthesis inhibition

Gene Forward primer (5′-3′) Reverse primer (5′-3′) Product size (bp) Annealing (°C)
alkB (MEMEG 1839) GCCTACATCCCGTTCCAGT AGCGAGTCCTTCTTGTGTCC 191 58
ectB (MSMEG 3900) AGGATTTTTCCGTGTTGCTC TTGTTGTGCCCGTAGTTCAG 214 58
katG (MSMEG 3461) GCCACCCAGGAAGAGACC GCAGGTTGACGAAGAAGTCC 265 58
mmpl5 (MSMEG 1382) CGAATCTGGCTACCTGTGCT GTGGCGGTCCTCTCTTCTTT 365 58
MSMEG 3359 CACCGACATACACTGCCAAC GAACCACGCCTTCTCCTG 310 58
MSMEG 3805 GGGGAGCCATTCTCAACG TGTGTTCCTCGGGCAGTTC 225 59
pcaC (MSMEG 6370) CGAGACCGAGCAGCGACT CGGGAACGGCATCTTCAC 250 59
gidB (MSMEG 6940) 1 ATGCCAGGGTGGTGAGAT CGTGAAACATTCGGCTTCT 270 61
MSMEG 3496 TATGAGCGTGGTGGTCCTG GCGGTCGTTGTAGTTGGTCT 229 61
MSMEG 3584 a TGTCGGAGTTGTTGATGGTC CTGTCGGTGTTCTCGTTCAG 241 61
MSMEG 5570 a CACCGAGAAAGAACTGAGCA GCAACTATTCCCACACAACCT 173 60
  1. a Genes used as normalizer gene