Skip to main content

Table 1 Primers used in real-time quantitative PCR (RT-qPCR)

From: Transcriptome comparison reveals key candidate genes in response to vernalization of Oriental lily

Unigene id Protein description Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) Length (bp) Correlation between RNA-Seq and qRT-PCR (r2)
Contig88790 AP2–type transcription factor GGTTTACTTGGGTGGTTTC TCCTCCTTCGTCAGATTG 153 0.97
Contig3170 Suppressor of overexpression of CO1 GCCTCGTGAAGAAGA CTCCAACAGAATCCTC 122 0.94
Contig88645 CBF–like transcription factor CAACTCGCTGGATGGCTGCT GCCACTCCGCCACACTCAAT 115 0.98