Skip to main content

Advertisement

Table 1 Primers used in real-time quantitative PCR (RT-qPCR)

From: Transcriptome comparison reveals key candidate genes in response to vernalization of Oriental lily

Unigene id Protein description Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) Length (bp) Correlation between RNA-Seq and qRT-PCR (r2)
Contig6022 FLOWERING LOCUS C CCTGGTGGAGAAGACGATGAGTG AACAAGATCAGCCGCCAAGTCA 117 0.98
Contig27291 Vernalization 2 GCTGCCAAACCCTGGTCATCA CATTATGCCTGGTGGTGAGTTCCC 111 0.99
Contig62859 FT-like protein GCGGCAACGATCTCAGAA CTCAAATATGGGTTACTGGGACTC 89 0.95
Contig88790 AP2–type transcription factor GGTTTACTTGGGTGGTTTC TCCTCCTTCGTCAGATTG 153 0.97
Contig3170 Suppressor of overexpression of CO1 GCCTCGTGAAGAAGA CTCCAACAGAATCCTC 122 0.94
Contig88645 CBF–like transcription factor CAACTCGCTGGATGGCTGCT GCCACTCCGCCACACTCAAT 115 0.98
Contig13712 LFY CGAAGAAGAACGGGCTGGACTACT AGGCAGTGGAAGGCGTAGCA 134 0.94
Contig22259 Maf–like protein CAAGATTCAAACCCGAGATG CGAGACGATGATGAGGAT 99 0.94
Contig76906 Auxin response factor 10 TAGATGGCACGGGCGAATATACCT CACACGCAGCCTCTTCACAGT 113 0.97
Contig27171 IAA type protein GTTCTCTTGCTTCACCATC ACATACTCCGTTCCATTCA 104 0.98